Microarray Probes on PGSC0003DMT400047370

Probe IDChipProbe Sequence
CUST_29688_PI426222305 JHI_St_60k_v1 GTTGTGCAGTACTATGTGTACCTTGTACATTGACCTGTAGAGTTATTAATAGATAGAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047370

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047370 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47500.1 +3 2e-82 269 193/487 (40%) cycling DOF factor 3 | chr3:17504276-17505964 REVERSE LENGTH=448

Transcript Sequence (1885 bp)

>PGSC0003DMT400047370 1885 pgsc_dm_v3.4
CAAACATCAAAGAAACAAAACAAGAAGATAAAAATTTGTTCCCATCTTACCCTTTTTCAA
GTAACACAAACTACTTTGATTTCTTTCCCCCTTTTTGTGTTGTAAAAAAAAGAAGGAAAA
TCAAGAATTGAGAAGAGGAATTCAAGAAAATGTCTGAAGTTAGAGATCCTGCTATTAAGC
TGTTTGGTAAAACAATTGGTATGACACAACAAGAAACCAATTGTGTTTATCTTCATGATG
ATCATACAACCTCATCCCCTCTTTCAATTGATGATGATAAGATCACTTTAGAAGGAGAAT
TTACACAAAGCAAACAAGATGATGAACTTGTCGATCCAACTGCAGACTCGTCGATTGAAC
CAGAAACATCATCTGGTATAAGCGATGACATCAAGATGCAGGATGCAGATAAAGAAACAT
TATCATCAAAATCTATCGAGGAGGAGGATTCGAGTGAGGAAAAGGCACTCAAGAAGCCTG
ATAAATTGATTCCATGTCCGCGATGTAATAGCATGGAAACAAAGTTCTGTTATTACAACA
ATTACAACGTCAACCAGCCTCGTTACTTCTGCAAGAACTGCCAGAGATATTGGACTGCTG
GAGGGACAATGAGAAATGTGCCTGTGGGATCTGGTCGCCGAAAGAACAAGAGTTCTTCCA
TTTCAAATTATCCTCTTCAAGCAGGTCGGGTCGAAGCAGCAGCTCACGGAATGCATCTTC
CTGCTTTAAGGACAAATGGAACTGTCCTTACATTTGGATCAGATAAACCCCTTTGTGATT
CAATGGTTTCTGCATTGAACTTAGCTGAGAATTCACATAATATGAATCGAAATGAATTCC
ATGGATCCGAACGAAGAATGCCTGCAATCGGGAATGATCAATCAAATGGAACTTGTAGTA
CAGCCTCAAGTGTAACTGACAAAGAAAGCAGTGCTGGTACTCATGATTTAGCAAATTGGA
ATAATTTCCAGCCATTTCCTCCTCAAGTACCGTACTTTCAGGGCGCTCCGTGGCCTTATT
CTGGCTTTCCAGTATCATTCTATCCAGCAACACCGTACTGGGGCTGCACCGTAGCAAACC
CTTGGAACGTACCTTGGCTTTCTTCTGATCAATCATCAGTCCAGAACAACAGTCCTACTT
CACCAACATTAGGAAAACATTCTCGGGATGAAAGCAAGATTGATCCATCACAATCACGGA
GAAGAGATGCTAATTTGCAGAATAGAGAAGGCGAGAGATGTGTACTGATTCCAAAGACAT
TAAGGATTCATGATCCAAATGAAGCGGCTAAAAGCTCTATATGGTCAACACTAGGTATCA
GGAATGAGAAGATTGATTCGGCTCGTGGTACAATGCTCTTCAGTGCCTTCAATCCAAAAG
CTGATCATAGAAATCGCGAACATGACACTTCTTTTGCCCTGCAAGCTAATCCAGCAGCCT
TGTCTAGATCACTTCATTTCCGCGAGAGCACACAATGATAAGACTTACAACATGGTTCAT
AGTTGCCTAGTACCAATCATTGATGTTAGTGCAGCTAACACCTAATCATGGAAATAGTCT
CTTGCAGAAATGCAGGGTAAAGCTGCGTACAATAGACCTTTGTGGACTGGCCCTTCCTCG
GACCTGCGCATAGCGGGTTCTTGTGTCTAGGAGGAGAAGGATACAGTATGCACAGAGTCT
TCAAGTTTTATAGTTGTGCAGTACTATGTGTACCTTGTACATTGACCTGTAGAGTTATTA
ATAGATAGAGATAAATAAGATGCAGCTGAAGTTTTTACTGACTTCTCATATTGATAGTTT
TATTCTGAATATTTACATTATTTTTATGATACTAAATCAATCATATTAATGGGCTTTGTA
CTTCTTGTAAAGATTCACTTTCTTG