Microarray Probes on PGSC0003DMT400047338

Probe IDChipProbe Sequence
CUST_32751_PI426222305 JHI_St_60k_v1 TCTGAAGAGTCACTTAGGAAAGTTATGTACTTGACCTGTTGGGGTCCATATTGAATCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047338

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047338 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G10270.1 +1 6e-12 59 39/89 (44%) Wound-responsive family protein | chr4:6374805-6375077 FORWARD LENGTH=90

Transcript Sequence (382 bp)

>PGSC0003DMT400047338 382 pgsc_dm_v3.4
CAATATCCCATTAGCAAAGATTTTCAAGAAATCAAAAATTAAATTTAGAAAATGAGTTCA
ACAAGCAAGGCATGGGTTGAGGCAGTGAAAGAACAAGGAGTGAGTAGGTGGAATTGCACC
ATCAAAACAATAAATCAGCATGCAAAGAACAATATAAAGTCATATTCACAGGCCAAAAAA
ATCTCTTCTCAATCTTCTTCTATGGTTTCTTCAAACAGTAAAGCAAAGCAGTCTGAAGAG
TCACTTAGGAAAGTTATGTACTTGACCTGTTGGGGTCCATATTGAATCTAATAATAGTGT
TATTTTTTGTAATTCTAGTTTGAGGCCCAATTGCTTAGAAAATAAATTATTAATGGAGAG
AAATATTTGAGCAATCCAGATA