Microarray Probes on PGSC0003DMT400047220

Probe IDChipProbe Sequence
CUST_32708_PI426222305 JHI_St_60k_v1 AAACATGGTGGGGATTTGCTATGTATATATTAATTAATGCTGCGTGTTCTTATATGTGCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047220

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047220 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G00870.1 +3 3e-78 256 168/434 (39%) basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr4:362230-363639 REVERSE LENGTH=423

Transcript Sequence (1747 bp)

>PGSC0003DMT400047220 1747 pgsc_dm_v3.4
CATGAATCGTCCTTACTCAACGGCTCAAGTTTGATTATCATTATACTCTTTCATCAATTA
AATAATACTACTCCGTACAACTACTAGAAGAAATGGAACAACTACTGGTTTCCTCATCTC
CCATGGCAGCAGCCTCACTACCTCCTCCTCCGGTAGACGTTAACCAGGTGCCGTTAGACC
TTCAACAAATGCTTCAATATGTTGTCAAAAGCCAACCAGAATGGTGGGCTTATGCTATTT
TCTGGCAGACTTCTACTGACGATGACGGAAAAAACTTTTTAGCTTGGGGAGACGGATATT
TCCAAGGAGACGGTGTGGTTAATAACAACAAAGGCAGCAGCAGCAGTAGCAGCAGCTTAA
AGTCACAGGCTCAGTCCGAGAGAAAAAAAGTCATTAAAGGAATTCAAGCTTTAATGGATG
GTAATGGAGATACTGATCTAGTGGACGATGGTGATGTAACTGACACTGAGTGGTTCTACG
TGATGTCGCTGGCCCGTTCTTTCTCCGCCGGAGATGGATCTGTTACAGGTAAAGCTTTTG
GAAGTGATGATTTTTTGTGGATAACAGGTCCGGCCCAATTTCAGCTTCATTACAGCTGTG
AAAGGGCTAAAGAAGCTCAGATCCATGGGATTCAGACTCTGGTTTGTATTCCAACTTCAA
ATGGCGTGTTCGAATTAGGGTCGACTCAATTAATCAAACAGAATTTGAGCTTAGTTCAAC
AGGTGAAGTCTCTGTTCCTCTGTTGTCCCCCTATTCAATTTTTAGAAAAATCAATTTGTT
TTGCTGATATTGGCCTCGTCACCGGCTTGCAACAAGATGACAATGACGATAAACTAAGAG
AAAATAGCAAAAAACAGCCGCAGCCTGTTGTAGCCAAAAAAAAAAGAGGGAGAAAGCCCA
AGGAGGATGCCAATATGGCGGCATTGAACCACGTGGAAGCGGAGAGACAGAGAAGGGAGA
AGCTGAACCACCGGTTCTACGCGTTGCGCTCCGTCGTTCCCAACGTATCGAGAATGGACA
AAGCGTCATTGCTATCAGACGCTGTGTCCTACATCAATCAACTCAAAGCCAAGGTAGATG
AACTGGAGTTGCAGCTAATTGATCACACTAAAAAACCCAAAAACGTAACGGAATCATCAT
CAGCTGACAACCAGAGCACCACCACTTCATCGGACGACCAAGTAATTAAGGCTAATTCCA
CAGCGGCCCCGGAGGTTGAAGTGAAGATAATAGGCACAGATGCAATGATCAGAGTTCAAT
CGGAAAACGTGGATTATCCATCAGCGAAACTGATGATTGCGCTTCAAAATCTACAAATGC
AAGTCCACCATGCCAGCATTTCATCCGTCAATCATCTCGTCCTTCATGATGTTGTGGTTA
GAGTTCCTCAAGGATTAAGCACCGAAGATGAACTAAGGACTGCTCTCCTTACTAGATTAG
AACATCACTAGCTCCGAATCAGTAAGCTCTCAATATTATTAGTACGTACAATCACTAGTT
AATTTTATTACCTTGGTTGTATCGATTAATCATCTCTACATGCTTATCTTTCATGAAAAA
TATATTATGTGATTGAATTACATTATGCTCATCAAGTTAATAATCATCGAAACAATTATA
CAAAAAAATATAACACGTGTTTCCGATTTGCCAGCTATGATTTGTTAACTGTGTGGGAGC
ATCCAACAAACATGGTGGGGATTTGCTATGTATATATTAATTAATGCTGCGTGTTCTTAT
ATGTGCG