Microarray Probes on PGSC0003DMT400045825

Probe IDChipProbe Sequence
CUST_38359_PI426222305 JHI_St_60k_v1 GAACCCAACTCTGTTGTTTATGTTAATTTTGGTAGCATTACTGTTATGACTCCTGATCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045825

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400045825 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G22380.1 +1 5e-122 363 175/298 (59%) UDP-glucosyl transferase 85A3 | chr1:7900522-7902332 REVERSE LENGTH=488

Transcript Sequence (960 bp)

>PGSC0003DMT400045825 960 pgsc_dm_v3.4
AAAAAATTGGATTTTATACCAGGCATGAAAGATGTACGTTTAAGGGATCTTCCAAGTTTT
TTGAGAACTACAAATCCAGATGATTTCATGATCAAATTTCTCGTCCAAGAAATGGAGCGA
GCGAGAAAAGCTTCCGCGATTGTCCTCAACACATTCAAGACACTAGAGAGTGAAGTTCTT
GAGTCACTCCAGACTCTCCTTCCACCAGTGTACCCAATAGGCCCCTTACATTTACTCGTC
AAATATGTTGATGACGAGAATTTGAAGGGGCTTGGGTCGAGCCTATGGAAAGAGGAGCCA
GAGTGTATACAATGGCTCAACAATAAAGAACCCAACTCTGTTGTTTATGTTAATTTTGGT
AGCATTACTGTTATGACTCCTGATCAACTTCTTGAATTTGCTTGGGGACTTGCAAATAGC
CAACAAGAGTTTTTATGGATCATAAGACCCGATATTGTATCGGGTTGTGAATCAATTCTT
CCACTCGAATTCGTGGAAGAAACTAAAAACAAGGGAATGCTTGCAAGTTGGTGCTCACAA
GAAGAAGTCCTAAACCATCCGGCAATAGGAGGGTTCCTGACTCACAGTGGATGGAATTCT
ACTGTGGAGAGCATTACTAGTGGGGTGCCTATGCTATGTTGGCCGTTTTTCGCGGAACAA
CAGACAAATTGTTGGTTTAGTGAGACAAAATGGGGTATTGGAATGGAAATTGATAATAAT
GTGAAAAGGGATGAAGTGGAAAGCCTTGTTAGGGAATTAATGGTTGGTGAAAAAAGGCAA
AAGAAATGAAGAAAAAGGCAATGGAATGGAAAGAATTAGGCTGAAATTTCAGCTAAAAAA
TCAACAGGATCATCTTATGTGAACATTGAAAAGGTGATCAATGATGTTCTTCTTGCATCC
AAACATTAATATGTTTGTAATTTTATCATTTGTTTTTCCTTCTTGTACAACACATGTGTG