Microarray Probes on PGSC0003DMT400045690

Probe IDChipProbe Sequence
CUST_27405_PI426222305 JHI_St_60k_v1 AAGCTAGAAAATGACCCTTTCTGCTCAAGCTTTTTTCCCAACTGAATAAATGGAGTTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045690

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400045690 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62230.1 +3 6e-99 210 128/349 (37%) ERECTA-like 1 | chr5:24996433-25002130 FORWARD LENGTH=966

Transcript Sequence (2387 bp)

>PGSC0003DMT400045690 2387 pgsc_dm_v3.4
TGGAACTACAAGAAAACCAACTTAGTGGTCCAATTCCTGCTTCCTTTGGCAATTTGAGAA
ACTTGCAATTTTTGTATCTCCACACCAACAAACTTTCTGGTTCTATTCCAAAAGAACTTG
CATTTTTGGATAACTTGGTTGAGCTGATAATAAATGAAAATCAGCTTTCAGGCCATTTGC
CTGAGCATGTTTGCCAAGGTGGGAAACTTGAGAACTTCACGGTGAATAATAACAAGCTCA
CAGGGCCAATACCAAGCAGCTTAAGCAAGTGCTCGAGTTTCAAAAGGCTGCGCTTCAATA
ATAACAGTTTTACTGGGAATTTATCTGAAGCTTTTGGCATCCATCCACACCTTCATTTCA
TTGATTTGAGCGACAATGATTTTTATGGTGAACTCAGCAGCAACTGGGGGAAATGCGAAA
ATTTGATTGATCTGCGTGTAGCCAGAAATAACATTAGTGGTAGCATACCACCAGAGATTG
GAAATGTCAAAGGGCTTTTAGGACTTGATCTTTCATCAAATCATTTGATTGGACAGATTC
CAAAGGAATTTGGAAAATTAACCTCTCTAGTTAATCTTTTTTTACAAACCAACCAAATTT
CTGGCAATATACCTGAGGAACTTGGGTCACTGACAAAGTTAGAGTCCCTCGATCTATCAG
ACAACAGATTGAATGGGTCAATACCGATGTGTATAGTAGATTTCGTGCACTTGTTTCAGT
TGAACCTGAGCAACAACAAGTTTGGCCAGAAAATTCCTAAGGAGATAGGGAGGATAACTC
AGCTCAATGTACTTGATTTAAGCTATAATCTTCTGGTTGGAGATATACCCCCTCAGTTAG
ACAATTTGAAGGTGTTGGTAAACTTAAATCTTTCCCACAATGGCCTATCTGGGCGCATTC
CCAGAGAACTTGATACTTTGACTGGTTTGCAGGATGTCATATTGTCATACAATGAGTTGG
AAGGTCCAATCCCTAATAATAAGGCTTTTATCAATGCCTCATTGGAGGGTAATAAAGGTC
TTTGCGGCAATGTAGCAGGACTCCATCCCTGCGAAATGTCGTCTTCTGTGGTGAAGAGGC
ACTCAAGGCGAAGGGACGTAAACTCATCCTCTTCACTGTACTTCCTGTTATGGGAGCACT
AGTACTGCTCTGTGTTTTCATTGGTGTTCTCTTTATGTGTAATAAAAGAAGGAAAGTTAG
AGACGTTGAAAGAAGGGATGATGATGGTTGGCTTTCAATATCCATGTTAGATGGGAAGGC
ATTGTACAGGGACATCTTAAATGCCACAGAAGAGTTTGATGCAAAATTTTGCATCGGGCA
AGGAGGACACGGAAGCGTTTACAAAGTAAGCCTTCTATCATTAGGGAATATAGCTGTGAA
GAGACTTCATTCTTCATTTCAGAATACACATCCCAAAAGCTTCATGAATGAAGTAAGGGC
ATTGACTGGGATTAAACACCGGAACATTGTGAACCTCTACGGCTATTGTTCGAAAGCACA
ACACTTGCTCTTGGTTTATGAGTATGTGGAGAGGGGGAGTTTGTCTAGTATTTTGAGCAA
TGAAGTTGAGTCCAAGAAATTGGATTGGCTTAAAAGGGTGAATATCATCAAGGGTGTTGC
TTTTGCTTTATCTTACATGCACCAAGATTGTTCACCACCCATTGTTCATCGAGACATAAG
TAGCAGTAATGTTTTGCTTGATTCTGAGTATGAAGCTCGTGTTGCAGACTTTGGACTAGC
GAAGATTCTCAATCCAGACTCATCCAATTGCACTACACTTGCAGGCACATATGGCTATGT
CGCACCTGCTTGCATATACTATGAAGGTTACGCAAATGTGTGATGTGTATAGCTTTGGAG
TATTATCATTGGAGATAGTCAAAGGAAAGCATCTTGGGGAATACATTACTGTGCTAGCAA
ATTCATCGACTATAGATCCTGAGCAGCTTAGCGATTTGCTGGATGAACGCCTTCCATATC
CTGAAGATAGAGTAAAAGATGTTTTGGTTTTTATCATCAATCTAGCATGCTCTTGTTTGC
TTAAAACTCCAAAATCAAGGCCAACAATGCACTTCATCTCTCAGAAGTTATCCTCAATGG
ATGCACGTCCACCTATTCATCAGAGAAACCCCCATGTAAGGCGAGCAATATATAATCCTT
GATATGTATGGAAATGTCGGTAGTGTGAAGTAAGTATTTCAATTGCTGGGACTAGTATTT
TTAGGGTTCTCATTTTGTTTACTGTATTTAAGACCTTATATTACAGTCGCACATAGTTCG
TCTTGGAAGTTTTCATTCGATTTCAAAGATTTTACCTGTATGTATAGAAGCTAGAAAATG
ACCCTTTCTGCTCAAGCTTTTTTCCCAACTGAATAAATGGAGTTGTT