Microarray Probes on PGSC0003DMT400044079

Probe IDChipProbe Sequence
CUST_50295_PI426222305 JHI_St_60k_v1 CAAGCCATAACTATGCCAGATCATTACCTCGACTATGTTCTTGAATGATATTATGAAATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044079

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044079 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G22104.1 +1 2e-17 81 47/105 (45%) Phototropic-responsive NPH3 family protein | chr3:7789814-7792179 FORWARD LENGTH=506

Transcript Sequence (643 bp)

>PGSC0003DMT400044079 643 pgsc_dm_v3.4
GTTGTGTTCAGTTAACTCGAATGAGGAAAATTACAAGCTTGAAAGATTTGAACATAACCG
AAGTAGCTCCTCATTCATGTCTAAAACCTTCCAAGTGCCTTGCCCTGGTCAGATCGCTCC
CGAGTCTGCTAGGGACTCGTATGATGCAATATACTATGCCAAGGTTATGTATCTTGAGGT
CGGTCGAAGGTTATCTGAAGTCAAAAAGATGAAAGTATGTAGTGGGCTGAGCTACGAGAA
GCTGTCATTTGAGGGTTGTAGCCACCTTGCTCGTAATAAAAATTTCCCTTCAAAATCTCC
TGGACAAGCTCTCATCACTTAGCAAGTGAAGCTCTAAAGCTTGCTTCAAGAAACCAATCA
AGTCAGCTCGATTCTCCCTTTAGTTTTGTGGAAACAGAAAATTCAGGAAACAAAGATCAG
CAGATCGTGTTATACGCAGGAAAGCTGGATCTTTCAATTGAGAATGAGAAGCTCAAAGAA
CATTTACAAGGTATGCAATGGAGAGTGCTAGAATTGGAAAAAGTTTGTAGGAAAATACAA
AATCAAATGGCAAAGATCTTGAAATCAAGAGTATCAAGCCATAACTATGCCAGATCATTA
CCTCGACTATGTTCTTGAATGATATTATGAAATCCAATCATTT