Microarray Probes on PGSC0003DMT400044013

Probe IDChipProbe Sequence
CUST_49045_PI426222305 JHI_St_60k_v1 TCTTCCTCATTTGTTAGCTATTGATGGGGTTTTTAAAATGCCTGGATTTGATGATTCTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044013

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044013 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G12890.1 +1 2e-22 95 64/200 (32%) UDP-Glycosyltransferase superfamily protein | chr5:4069658-4071124 REVERSE LENGTH=488

Transcript Sequence (609 bp)

>PGSC0003DMT400044013 609 pgsc_dm_v3.4
ATGAGTGACCATCAAGAACATATAGTAATCCTTCCATATCTTGCACTTGGCCATATGATA
CCTTTCATAGCCTTAGCGAAAAAAATTCAAGAAAAAACCAACTTCAAAATCACTATTGTT
AGTACCCCTTTAAATGTCAAATATCTAAGTTCCACTATAGCCAAAGATTCAACTAATTCA
AATAACATTTCAGTAGTTTCACTTACTTATAATAGTAGTGAACATTGTTTACCACCAAAC
ACAGAGAACACAGAGTCCTTACCTTTAAAACACATGGTGACAATTTTGAACTCAACATTA
TCTCTTAAAGAACCACTCAAAAAATTGATTCTTGAAATTATTGAAAAAGATGGTAACCCA
CCACTTTGTATAGTTTCTGATACATTTATGGGATTTGCTAGTGAAGTTGCAAGATCTTGT
GGAACTTTTAATGTGAGTTTTACTACTGCTGGTGCTTATGGAACAGCAGCTTATGTGTCA
CTATGGTTAAATCTTCCTCATTTGTTAGCTATTGATGGGGTTTTTAAAATGCCTGGATTT
GATGATTCTTGTTGTTTTTTCTCTGTTGAACAACTTCATCCATTTATGAAATTAGCTAAT
GGGGGATGA