Microarray Probes on PGSC0003DMT400043945

Probe IDChipProbe Sequence
CUST_3323_PI426222305 JHI_St_60k_v1 CCATAATATGTTGGGTTTTCTAGCTTTTTTCTAACAGCTGATCTAGAAGATCATATGCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043945

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043945 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G33565.1 +1 4e-18 84 40/110 (36%) RING/U-box superfamily protein | chr4:16136821-16137924 FORWARD LENGTH=367

Transcript Sequence (1017 bp)

>PGSC0003DMT400043945 1017 pgsc_dm_v3.4
TCTGACTAAGTTTGAGAAGTTTGTGCATTGATGAGGTCATGCAATTTGAATTTCAGGTGC
AGTATATGCTTATCGGAGTACCAGGAGAACGAAATTCTGAGAATTATGCCCAAATGTGGC
CATAGTTTCCATCTTTCATGCATTGATATATGGCTAAGAAAACAGTCTACCTGTCCAGTT
TGTCGTCTTTCCGTACAGGAATCTATTGAAAACAAACAAAGGCGCCCTGCAATGCTTGGC
AGGGATCAAAACTCTGACAGTTCTGAGATTTCATTGGAGCATTCAAGGCAGTGGTTTCTA
CGTACTGCTGAACGGTCACAAGGTACTGTAAGTAACAGCAATGAAGCAGTTTCTGTTTCA
ATTAATCCTGAACCTGAGGTCTCTCGGGAAGCAGAAGCAAGGTCATGACGGAAGGCAAAT
ATAGAGGTACCATAAGAAATTATGCCTTCTGTTTGCATTCAGATGTTTCCTTGTATCAGA
CCTATCTTATTGGAGACTGACAAATGGGACTGATTCTGAACAAAGAGAATCTGAAGACAC
AGAGGAAGGACACAGAAACTTCTGTAGATGAATGTTGCATATAACCGGTTAGAAGATCTA
GTTGCACTCTTTTAGCAATTCGGAGATTTTGGACCAAGTTTGTGGCACACTGGTTATCCT
ATCAAAACACAGTGCATCTTATATGATGTTGTACAATGTCAAATCTTCTGTAATATCACT
GTAAAGAAGGCGTTTAGAGTCTCCGTTTTTTATCATAGACATTACCAAAGTAGACAACGA
ACTAAAGTCTTATTGAAATACTCTAGAATTGGCTCATTTGAGGGTCATATACTCTGTAAG
AATATGAGCCTCCATACACCACTTTTAGTAATTTACAGTCAAGTTATGCTTATAAGTTTT
TACCTCACTGCAGTTCTGGTTTCTGATATGCAATATCCAGAATATGATGAAACCATAATA
TGTTGGGTTTTCTAGCTTTTTTCTAACAGCTGATCTAGAAGATCATATGCCTATAAA