Microarray Probes on PGSC0003DMT400042691

Probe IDChipProbe Sequence
CUST_43206_PI426222305 JHI_St_60k_v1 GCAGCTTCTTGTTTGTTGAGTTAAGGTCCACAATTTTTTGTACATGGTAGCTCAAAAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042691

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042691 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G29510.1 +1 5e-40 136 79/147 (54%) SAUR-like auxin-responsive protein family | chr1:10322683-10323114 FORWARD LENGTH=143

Transcript Sequence (632 bp)

>PGSC0003DMT400042691 632 pgsc_dm_v3.4
TTTAGCCATCAAATTTCTCTAAATTTCTCATTCAATTTCTTGTTTCCAGTCTTCAAAGGA
AAAATGGCAATGCTCAGCGCTAAGAAACTCATCAAGATGGCCAGGAAATGGCAGAAGTTT
GCAGCCATGCAGAGGAAGAGGATTTCATTTCCAAGAAATGGTAGTGATGCAGACAGTTGC
AGTACATCTTCATCTTCTATGGTTGAGAAAGGCCATTTTGTAGTATATACAACTGATCAA
GCCCGTTTTGTCGTTCCCTTGGCTTACCTTGAAAATGAGATCATAAGGCAACTTTTAAGC
ATGTCCGAAGAAGAGTTTGGGTTGCCGAGTGGTGGCCCTATTAAATTACCCTGTGATTCA
TCCTTCATGAGCTACATCATTTCACTAATCAAGAAAGGTGTAGCTGCGGGAGATCTTCAC
AAAGCAGTGCTCCTCTCGATTCCTTCATGCTGCTGTGCAACTTCTTCTATGCACCAAGAA
ATTGGAAGCCAGCAGCTTCTTGTTTGTTGAGTTAAGGTCCACAATTTTTTGTACATGGTA
GCTCAAAAATAGGTTTTAGAAAGGCGGACATTGAAGAGTACACAATTGTAAAGAACATCA
TACAAATTGAATACTACTTTATTTGAAAATTT