Microarray Probes on PGSC0003DMT400040310

Probe IDChipProbe Sequence
CUST_31010_PI426222305 JHI_St_60k_v1 ATGACAAGTGCTTTAATTAGAGAGGAACTTGATCGGATGGGAGTTAAATACCGGTGGCCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400040310

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400040310 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G51760.1 +2 1e-154 452 224/408 (55%) peptidase M20/M25/M40 family protein | chr1:19199562-19201424 FORWARD LENGTH=440

Transcript Sequence (1508 bp)

>PGSC0003DMT400040310 1508 pgsc_dm_v3.4
TATAGTCCCATAGTGGGTCGCTTTGAAACCACAAAATAAAAAATACCCACAAATTTTCTT
GATAAATTTTTCACAAATTATGGGTACTAAGAAAGTTTTGGTGTTGTTGGTGTTTTCTAT
GTTCATGTTTTTTTCTTTAGGGCACGAAGAAGAGTGTCTGAATCCATTTTTGATTGATCA
AAATATTTTCGCGAAAGATCATATTATAAATTTAGCGAATGATACTGAGACAGTCAAGTG
GATGAGGAAGATAAGGAGACAAATTCATGAGAATCCAGAGCTTGCTTATGAAGAATTTAT
GACAAGTGCTTTAATTAGAGAGGAACTTGATCGGATGGGAGTTAAATACCGGTGGCCGGT
GGCTAAGACTGGCGTTGTTGCAGCCATCGGCTCCGGTAAGCCGCCGTTTGTTGCTCTTAG
AGCTGATATGGATGCTTTGCCTATTCAGGAATTGTCAAAATGGGAACACAAGAGCAAAAT
TGATGGCAAAATGCATGCTTGTGCTCATGATGCACATACCACAATGCTTCTTGGTGCTGC
TAAAATATTACAACAACTCCAACACAATTTACAGGGTACGGTTGTGTTAATTTTTCAACC
CGCGGAGGAACGAGGGCACGGGGCTAAAGATATGATAGATGAGGGTGTTCTAGAAAATGT
AGAAGCCATATTTGGTATGCATTTAGTACATAAGTATTCAAGTGGTGTAGTTGCATCTAG
GCCTGGTGAATTTTTAGCTGGATGTGGAAGTTTTAAAGCAACAATTAGAGGCAAAGGAGG
ACATGCTGCTATACCACAAGATACTGTTGATCCTATTTTGGCTGCTTCTACTTCTGTTAT
TAGTTTGCAAAGTATTGTGTCAAGAGAGGCTGATCCTCTTGAATCACAGGTTGTTTCTGT
GGCTATGATTCAAGGGGGGTCATCATTTAATGTCATACCAGATTCAGCTACAATTTCTGG
GACTTATAGAGCATTTAGTAAGAAGAGTTTCTATGGTTTGAGGAAAAGAATTGAAGAGAT
CGTACGAGCACAAGCAGCTGTACATAGATGTACGGTGGAGATTGACTTTGATGGTCGTGA
AAATCCAACACTTCCTCCAACTATAAACAATGAGAAAATATATGAACATGCTCGAAAAGT
ATCGAAAATGATCGTTGGAGAGGAAAACTATAAATTATCACCTAGTTTTATGGGAAGTGA
AGATTTTGCTGTGTTTTTAGAGAAGGTCCCTGGATCATTATTCTTATTGGGAACAAAAAA
TGAAAAGATTGGTGCAATTTATCCTCCACATAATCCAAATTTCTTCATTGATGAAGATGT
TCTTCCAATTGGAGCAGCAATTCATGCAACTTTTGCATATACATACCTTTTCAATTCTAC
AAATAAGTGTACTAATTCTCATTCTTCTTATTAGGAATCATGTAAAGCATTCTTTAGTTT
TTTGTTTTTTTTTTTGTATGTTACATCTATATATGATCATTAGTTCCAGTCCAATTTTCT
TTAATTTC