Microarray Probes on PGSC0003DMT400040285

Probe IDChipProbe Sequence
CUST_31012_PI426222305 JHI_St_60k_v1 CAACCCAGAAAAAGAAGAGTTTTTACTGAATCACTCACAAAATTCAACAAAGGGAGGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400040285

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400040285 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G52190.1 +2 0.0 536 258/566 (46%) Major facilitator superfamily protein | chr1:19434671-19438673 FORWARD LENGTH=607

Transcript Sequence (2001 bp)

>PGSC0003DMT400040285 2001 pgsc_dm_v3.4
TATCAACAAGTATATTTTTGTATCTATTGAATCATAACAAGATCTGTTCCAAGAGGTTAG
ACTGAAAGAAGAATTTGAACAAGGAAGAAAGAAAATGGAAAACAACCCAGAAAAAGAAGA
GTTTTTACTGAATCACTCACAAAATTCAACAAAGGGAGGTTTAAAAACCATTCCTTTCAT
CATAGTGAATGAATCATGTGAGAAAGTGGCAAGTTTTGGGTTGCAACCAAATATGATAAT
CTACATAACAAAATTTTACAATATGGATGCTGCTCGTGCTTCAGTTTTGATTAGTTTATG
GTCAGCAATTTCAAATGTATTGTCTATTTTGGGAGCTTTTATTTCTGATTCTTACATTGG
AAGGTTTAGGGCTGTGGCTATTGGAACCATCTCTAGTCTAATTGGAATGCTTGTTCTTTG
GCTCACAACAATATTTCCACAACTCAGGCCGTTACCCTGCGGTCAGTATCAACATGATTG
TAATGGAACAACAGCAGCTCAACTTGCTGCAATTTTGTTTTCTTTTGGGCTTATTTCCAT
TGGTGCTGGTTTTGTTAGACCTTGTTCCTTAGCATTGGGTGCCGACCAATTGGAGAACAA
AGAAAATCTAGATAACGAGAGGCTTATCGATAGCTATTTCAACTGGTTCTATGCCAGTGA
AGGAGTTTCAGTTCTTCTTGCAGTTACTGTAATTGTTTATATCCAAGATCATTTTGGTTG
GCAAGTTGGGTTTGGTGTCCCTGCTTTGCTCATGGTTTTATCTCTTTCTGTTTTCTTGAT
CGGATCTCCTCATTATATCAAAGTAATACCTCAAGGGAGTTTGTTTACTGGATTGTTTCA
AGTACCAGTCGCAGCCTTCAGAAAAAGACACATCAATGTTCAGTTGAATTATAGTGATGA
CTGCTACTATAAAGCACCTCAATCAAAGCTCCTTGAACCATCCACTGACTTCAGGTGTTT
GAATAGAGCTTGCATAATTGAAGATCCTCACATGGAGTTGAAACCTGATGGAAAAGCTTC
AGATCCATGGAGTCTCTGCTCTGTCGAACAAGTCAAAATAATGAAGTGTTTTCTTACCGT
TCTTCCCATGTGGTCCACCTGTATTATGCTTCTTGTGTCGTTGAGTCAGCCACTTTCGAT
ATATCAACTACTGACCGTGGATAGACACATTACCCCTCAGTTTGAAATCCCAGCAGGATC
ATTTGGCATGATTACCCTTCTTTCTTTGACAATCTGGTTTGCTTTTTACGATCGTGCATT
GGTGCCTTTACTGTCAAGGTATACTGGACTGCCGACTGGGATAAGTCCATTTTCCAAAAT
GGGGATTGGCTTAATTGTGGGCATTGTGGCTACGGTACTTTCAGCTATTACAGAAACCAT
ACGACGCAATAAGGCAATCAATGCAGGGTTTGAGGATGACCCGAATGCTGTGTTAAACAT
GTCCTCTATGTGGTTTGTTCCACAGTTGGCACTATATGGGGTGGCTGAGGCTTTGAATGT
GGTTGGACAGATTGAGTTCATATACAGTCAATTTCCAAAAACCATGTCCAGTTTTGCAGC
AGCTCTTTACACGTTTGGCCTTGCGCTTGCCAACTTAATTAACAGTCTCTTGGTGAGCGT
GGTGGATAGTATTACCTCAACCGGAGGCAAGACAAGCTGGCTCGCAACCAACATAAACAG
AGGTCATCTAGATTACTACTGCTGGCTAATGACTTCATTATGTGTGATTAACTTCCTCTA
TTTTTTAGCCGTTTGTCAGTTTACTGATCAGCATCACCATGATGGTAGGAGTAGCTTATT
TCCTGAGGCAGAAGAGGAACACACCGCGAATAAGCGTTTCCATGGTGCTTAATTGTAACA
ATCAAGTGTGTACGCTATTAAATGTTTGGTTAGATTAAATGTATTCAAAATTAACTTGTT
TTCCTCAAATTTAAGGAAAATGACTTCCATTCAAAAATTAAGGAAAACATTTTCCAAAAC
TCTACTTCATTGTTAAATATT