Microarray Probes on PGSC0003DMT400040274

Probe IDChipProbe Sequence
CUST_31051_PI426222305 JHI_St_60k_v1 AGAAATACCCGTCTTTCATTGAGTGATTGTGGTGAATACTATCGTTGGCCACATGAATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400040274

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400040274 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G16180.1 +2 2e-39 135 59/114 (52%) Major facilitator superfamily protein | chr3:5481477-5484943 REVERSE LENGTH=591

Transcript Sequence (545 bp)

>PGSC0003DMT400040274 545 pgsc_dm_v3.4
GTTTAACATTTTTCTTGGACAGGGAATGATTATTCTATGGCTCACAGCAATGATTCCCCA
ACTCAAGTCTTTACCCTGCTCTCATTTCCAACATGTTTGTAATGGACCAACACTACTACA
ACTTGCTGTTCTGTTTTCATCTTTTGGATTTATGTCCGTCGGAGCTGGTTTTGTTAGACC
TTGTTCTATAATATTTGGTGCTGATCAATTGGAAAATCGAAAGAACAAGAGGATTCTTGA
AAGATATTTCAATTGGTACTATGTTAGCACAGGGATTTCAACTATTCTTGCAGTTACCCT
TATTGTTTATATTCAAGATAGTTATGGTTGGAAAGTTGGCTTTGGTGTTCCCTGCTATCC
TCATGTTTTTGTCTGTCTTAATGTTCCAAATCGGCTCTCCTCTTTATATCAAAGTGAAAG
CTAAAACTAAACAAAACTTGGTCATAGGATTGTTCCAAACAGTTGTAGCAGCTTTTAGGA
AAAGAAATACCCGTCTTTCATTGAGTGATTGTGGTGAATACTATCGTTGGCCACATGAAT
CAGAG