Microarray Probes on PGSC0003DMT400038139

Probe IDChipProbe Sequence
CUST_45986_PI426222305 JHI_St_60k_v1 AAGAAAACAAGTTCTTTTTTGGGGACGCGGTGTTTGGGTTGAGTTTCCCGAGCATGATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038139

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038139 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G28720.1 +2 0.0 605 283/378 (75%) Flavin-binding monooxygenase family protein | chr4:14192688-14193968 FORWARD LENGTH=426

Transcript Sequence (2179 bp)

>PGSC0003DMT400038139 2179 pgsc_dm_v3.4
CTCTTCTCTCTCTTTACTACATTCACAACTTCAAATACACATTCACTTATTGATCTTGCT
GCTACGATCCACTGATATTCAGTTCTTTACTATATCGTGTTCAAGTACTCATCCACCATC
ATTGCTCAATCAAATTTTGAATAAAAAAATACGTTCGTGTTCTGCTTTCAGAGTCAGCCC
TCAACATTTTCACTAGAAAAAAAAAAAACCAAATTCCTCCTATTTCAAGTCATCAAACAC
TATCATTGCTTGATTAAAATCCAGAATAGCAGAAATAGGTTCGTGTGCTGCTTCCAAAGT
CGATCACCAAATTTTCACAAGAAAATACCACTTCAAAAACAAACTTAAACCAACTTCCTC
TTCTTTCAAGTCTTCACACCACTACCATTGCTCAATTAAAATTCAGAATAGCAAAAATAG
GTTCGTGTTCTGCTTTCAAAGTCAGACATCGATTTTTTCCACTAGTCAAAACCATTTCAA
CAACAAACTCAAACAACCTTCCTCTTCTTTCAAGTCTTCATACACTACAATCACAAAAAC
ACGCTCGTGTTCTGCTTTCAAAGTCTGTCGTCGAATTATGGTTAGCTTTAATGGTCAAGA
TTTGTTTTCTAGTAGATGTGTATGGGTAAATGGTCCTGTTATTGTAGGTGCAGGGCCATC
AGGACTAGCTGTTGGTGCTTGTTTAAAAGAACAAGGTATCCCTTTTGTAATCTTGGAAAA
ATCAGATTGTATTGCATCTCTATGGCAAAAAAAAACTTACAATAGATTAAAACTACACCT
CCCTAAACAATTTTGTCAATTACCCAAATTTCCATTTCCACAACACTATCCTGAGTACCC
TACAAAGAAACAATTCATTGATTATCTTGAATCATATGCTAGAAAATTTGACATCAATCC
AATGTTTAATGAGTGTGTTCAATTTGCAAAATATGACCAAATATGTAAATTGTGGAGGGT
GAAAACTATTTCACCAAATGGATTAGAAGTTGAGTATATTTGTCAATGGCTTGTTGTGGC
TACAGGGGAAAATGCTGAGAAAGTTGTGCCTAATATTGAAGGATTAAAAGAATTTGGAGG
TGAAGTTATTCATGCTTGTGATTATAAGTCTGGTGAAAAGTTTAGTGGGAAGAAAGTTCT
TGTTGTTGGTTGTGGAAATTCTGGCATGGAAGTTTCTCTTGATCTTAGCAATCATAATGC
TCATCCATCATTGGTTTGTCGTAGCTCGGTTCATGTATTGCCAAGAGAAATTTTTGGGAA
ATCAATATTTGAATTGGCTATGTTTATGATGAAATGGTTACCATTGTGGCTAGTTGACAA
AATTTTACTAATTTTGACATGGTTCATTCTTGGTAACATTGAGAAATATGGACTAAAAAG
GCCAAAAATTGGTCCTTTGGAACTCAAAAATACACAAGGGAAAACTCCTGTTTTGGACAT
TGGTGCATTGGAAAAAATTAGATCAAGAAAAATCAATGTTGTCCCTGGAATCAAGAAGTT
TTCATGTGGCACCGTTGAACTTGTCAATGGTGAAAAACTCGAAATTGATTCTGTTGTTCT
TGCTACTGGTTATTGCAGCAATGTCCCTTTTTGGCTAAAGGAAAGTGAATTCTTTTCCAA
AAATGGATTCCCAAAAGCACCATTTCCAAATAGTTGGAAAGGAAAATCTGGGCTATATGC
AGTTGGTTTCACAAGGAGAGGGCTATCAGGTGCTTCTGCTGATGCTATCCAAATTGCACA
AGATATTACCAAAGCTTACAATGAAGATATTATGCAAAAGAAGCAAAAAATCTCAACCTT
GTGATTTAATTGAATCATATAGAGATTAATTTTGTGAAAAAATAGGTAGCATAGATAGAT
TAGCCCTCTCCAAAATCCCAAGTTTTGGTATAGTTTGGGAGTTTTTGTATTATAAGTTGT
CAGATCCTCCAAAAGAAAAAAGGTTAGGTGAAAAGAAATTGCATAAGTTGTCAAGTCCCC
CCCAAAAAGAAAACAAGTTCTTTTTTGGGGACGCGGTGTTTGGGTTGAGTTTCCCGAGCA
TGATGAGGTGGTCTAGTTTTTTTTATTTTCCCTTTTCACCCCTTTTTCAACTTTGACTTT
AGTGTTCACTTATGTTGATATTTTTGTACATATTTGTACAATTACTACTGATTATTAATC
AAAGTGACAAAGATATTTC