Microarray Probes on PGSC0003DMT400037693

Probe IDChipProbe Sequence
CUST_11069_PI426222305 JHI_St_60k_v1 CCTATTCAGATGGACAAAACAGAGGATTTGGAGACTAAAAAAGATGGGATTGAACTTGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037693

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037693 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G68570.1 +3 0.0 855 415/588 (71%) Major facilitator superfamily protein | chr1:25746811-25750110 FORWARD LENGTH=596

Transcript Sequence (1945 bp)

>PGSC0003DMT400037693 1945 pgsc_dm_v3.4
ACAAAATTTAAGCTCTGGCATATCCTATAAATAGTGGAGCTTTAGGAATCATTTAGAACA
CACAATTACATACAAATATGGAAGTGATGAATAAGAAGAAAGTTAACTCCTCTAGAAGGA
TGAAGGGTGGAATGATCACTATGCCCTTCATATTTGCAAATGAGATATGTGAGAAATTGG
CAGTGGTGGGATTTGGTACAAATATGGTCATTTACTTGACAAATGAGCTCCATCTTCCAT
TAACAAAAGCAGCAAACACACTTACAAATTTTGGTGGCACTGCAAGTTTGACACCATTGA
TTGGAGCTTTTATTGCTGATACTTTTGCTGGAAGATTTTGGACTATAACTGTTGCTTCTA
TCATCTACCAAATTGGCATGATCATTTTAACATTATCAGCAATACTTCCACAACTAAGGC
CACCATCATGCAAAGATGATGAATATTGCAAAGAAGCAAATTCAAGTCAATTAGCCATCT
TATATGTGTCATTACTCTTAACAGCCTTTGGGTCAGGTGGAATTAGGCCATGTGTTGTTG
CATTTGGGGCAGACCAATTTGATGAAAATGATCCAAATCAAAAAACACAAACATGGAAAT
TCTTTAATTGGTACTATTTTTCTATGGGATTTTCAATGCTTGTGGCTGTCACAGTAATTG
TTTATATTCAAGATAATATTGGATGGGGTATTGGATTTGGTGTCCCAACAATTGCTATGC
TTATATCAATTGTTGTTTTTATATTTGGATACCCTTTGTATAGAAATTTGGATCCTGCTG
GTAGCCCTTTCACTAGGCTAGTGCAAGTTTGTGTTGCTGCCTACAAGAAGAGAAAATTGG
ATATGGTAAATGATACTAATTTGCTTTATCAAAATCAAGAACTTGATGCTGATATTTCTA
CTGCTGGCAAGCTTGTTCACACTAAGCAAATGAAATTCTTGGACAGAGCAGCAATAGTAA
CAGAGGAGGATAACCCGAAATCTCCCAATCTATGGAGGCTAAACACGGTCCATCGCGTAG
AAGAGCTAAAATCGATCATAAGAATGGGTCCAATATGGGCATCAGGGATCATCCTGATCA
CAGCATACGCACAACAACACACATTCTCAGTCCAACAAGCCAAAACAATGGACAGACACT
TGATAAATTCCTTCGAAATTCCAGCTGCCTCGATGACTGTCTTCACATTAACAACAATGT
TATGCACCGTTGCCTTCTATGACCGCGTATTTGTCCCTATTGCACGTAAGTTCACTGGAC
TCGAAAGAGGAATCTCTTTCCTAAGCAGAATGGGAATTGGATTCTTCATATCTGTCCTAG
CCACTTTAGTAGCTGGATTTATTGAAGTTAAACGAAAAAATGTTGCATCAACTTATGGAC
TAGTCGATAAACCAAAATCAATAGTTCCAATTTCAGTATTTTGGCTTGTGCCACAATATT
GTCTACATGGTATAGCTGAGGCATTTATGTCAATTGGACATCTTGAATTTTTCTATGATC
AAGCTCCAGAGAGTATGAAAAGTACAGCCACCGCGTTATTTTGGACATCGATTTCAGCTG
GGAATTATTTGAGTACATTTCTGGTAACGTTAGTTCATAAATTTACTTCAGGACCGAGAA
GAACCAATTGGCTGCCTGATGATAACTTGAATAAGGGGAAATTAGAGTATTTTTACTGGT
TAATTACAATTCTACAAGTGGTTAATTTGATTTACTATTTGTTTTGTGCAAGATTATATA
CTTTTAAGCCTATTCAGATGGACAAAACAGAGGATTTGGAGACTAAAAAAGATGGGATTG
AACTTGTAAACAATGTTTAGTTTGTATTTTGTAACTTTAGTTTATAGTATTATTATGTAA
TAGTTTTTAGTTTATGAGGAAAGAAAATAATGGTTATGAATAGTTGAATGTAATAATTAT
TAATAGATGGAATAGTAAGACTTTG