Microarray Probes on PGSC0003DMT400037015

Probe IDChipProbe Sequence
CUST_26433_PI426222305 JHI_St_60k_v1 GGTGCAGTTTGTACTCTAGCTAAGAAAATTACTACTCCATCAAATTTTGTTCATTTGCTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037015

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037015 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G23030.1 +3 0.0 588 317/473 (67%) MATE efflux family protein | chr4:12072857-12074365 FORWARD LENGTH=502

Transcript Sequence (1883 bp)

>PGSC0003DMT400037015 1883 pgsc_dm_v3.4
CAAAAACTTCTTCCTCGTTCGTTCCCTCATTATAAACTCTATTATCTCTTTCTCTCTTGA
AGAGAAAAATGTGTAAGCCGACAAGTCCACCATTCACCTGCAAATGCGATGCATATGCAG
AAAATAATTTCGTCTCCATTAAAGTTGCTGAAGAATCCGACATGTCTACCCCTTTGATAC
CTAAAAGCCCAACAAACGACACTTACCCCCACATAACCAACAAGAAAATAACTTCTCTTG
TCTTCAATGAAGCTAAATCCATTGCTAATATCGCTTTTCCTATGATTCTTACAGGCCTTT
TGCTTTACTCTCGCTCTATGATCTCTATGCTTTTTCTTGGCCGTCTCGGCGGTTTGGCTC
TTGCTGGCGGATCTCTTGCAATTGGGTTTGCTAACATTACTGGATATTCAATTTTATCTG
GTTTAGCCATGGGGATGGAACCCATTTGTGGACAAGCTTTTGGAGCCCAGAAGTATAATC
TTCTTGGGCTTACTTTACAGAGAACTGTTCTTTTGCTTTTATTAATTTCATTCCCAATTG
CTCTGTTTTGGGTTAATATGAAGACTATTCTGCTTTATTGTGGCCAAGATGAAGATATTG
CTACAGAAGCACAATCTTATTTGTTCTATTCACTTCCAGATTTATTCGCGCAATCTTTAC
TTCATCCGTTGCGTATTTACCTTAGAACTCAATCGATTACTCTGCCTCTGACTTGTTGTG
CGATTTTCGCGATTCTTCTGCATATACCCATAAATTTTCTTCTTGTTATTAAGCTTAATT
TGGGGGTTAGAGGAGTTGCTATGAGTGGGGTTTGGACAAATTTTAATCTAGTAGGTTCGT
TAATTGTATATATTGTTGTTTCTGGTGTTTACAAAAAGACATGGGAGAGATTGTCAATGG
AGTGTCTCAAAGGATGGAAATCGCTTTTGAATTTAGCGATCCCAAGCTGCATTTCAGTCT
GTTTGGAATGGTGGTGGTATGAGATCATGATTTTGCTATGTGGGTTGTTGATTAACCCGA
AAGCAACGGTTGCTTCGATGGGCATTTTGATTCAGACGACTTCATTAATTTACATTTTTC
CATCATCTCTTAGTTTCAGTGTATCAACTAGAGTTGGGAATGAGCTTGGAGCAAGGAGAC
CAGGTAAAGCGAAGGTAGCTGCCATTGTAGGCCTTGCTGGTAGCTTCATTTTGGGTTTTA
CAGCTCTATTTTTCGCGGTGACGGTGAGGAACGTTTGGGCCAAGATGTTTACTAATGACA
AAGAGATATTGGCGTTAACATCAGTTGTTTTACCAATAATTGGGCTTTGTGAATTGGGAA
ACTGCCCACAAACAACTGGCTGTGGGGTTTTGCGAGGAACAGCGAGGCCTAAAGTTGGGG
CAAATATAAATTTAGGATGCTTTTATATCGTTGGTATGCCAGTAGCAGTGGGGCTAAGTT
TTTATATGGGATTTGATTTTCAAGGATTATGGATCGGACTATTGGCCGCACAAGCCTCTT
GTATGCTCACTATGTTGCTTGTTCTGCTTCATACAGATTGGGAATTCGAAGCAATCAGAG
CCAAACAACTAACAGGAACTACCATTCTCGATGAAACGAAAGAAACAATTCAAGAAAATA
CTAGTAGTAATAAGCAACTCAATGAGAATTTTTTATGTTAACAATTTTAATCTTTAATTT
TTCTGTATAGAGGGGAGGGGGCAGGGGTGCATTCATAGGCTGAAAATGAAGCAAACTCTT
TTGGTAATTCTGGTGAGGTTCAAAATGGGAATATCACAGGATATGACAAGAGATTGTAGC
TGGAAAAACCAGCAAGAAGAAAAGGTGCAGTTTGTACTCTAGCTAAGAAAATTACTACTC
CATCAAATTTTGTTCATTTGCTG