Microarray Probes on PGSC0003DMT400035849

Probe IDChipProbe Sequence
CUST_49747_PI426222305 JHI_St_60k_v1 CGTCTTGAGCAATTAGGATCTGGATAATGTAGACCAAACCTCGTGTAAAATTAGTTTTCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035849

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035849 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G57740.1 +1 9e-52 184 122/360 (34%) Protein kinase superfamily protein | chr3:21392671-21393744 FORWARD LENGTH=357

Transcript Sequence (1918 bp)

>PGSC0003DMT400035849 1918 pgsc_dm_v3.4
CATGAATTCCATCTTGTGACCCCCACTGTTATGACTTATGCCTCCCCCATCGTTATCACC
CATTCATGGAATTTTCAATCAAAGTGCTTGCAAATTCAATTTTGTGTGGAATTGAATCCA
CAAATTAAGACCAGCAGGAAACTTCTTCTAACTTGTTCATACATTACTTACAGTACTACT
GATATGCTTTATTTCAATCCCAATTCATCATCCAAACGATTAGTCACTTCAAAATTAGAG
CAAAGAAAAATGCCTTTCTTCATGGGACTCAAAAGGAAAATACTTTTTTCCTCTGCCTCT
GCAGCAAGGCGGAAGAAAGAGAAAGATTGTTATTTGAAGAATGGAAGTTGCGTACTTGAG
GAGCTTCTTGCTTTATGCGACGGAAATTGCAGAATTCCCATCCGTTACTTCACTGCCACT
GAGATCCACAATGCAATTAAACATTCTAAAACCAAAATGGACCTTGCCATGGTGTCGATG
GTTACGGGATCACTTGACAACCGCCTTGTTTTAGTTAGGTTCAATACATGTACAACATTC
AATATCCACAGAGATGTAGCAATTACTGCTCAGATGAGTCATCTGAAGAATGTGTTGAGA
CTTGTCGGTTGCTGTCTAGAATTTGAACAGCCAGTGATGGTGTATGAACATGTTGAAGCT
ATATCTCTTTTCGATCTACTTTTCAAAAAGGATAATCTTAATAGAAAATCTCTATTATGT
TGGGGAAATAGATTACGAGTTGCACGTGAGGTTGCTTCTGCAATAGTTTTCCTGCATACT
GAATTTACTACGCCCATCATCCACAGAAATATAAAGCCTCACAATGTGATAATAGATCAG
AACAGCGGCACTGCCAAAATATTGAACTTCGCACTCTCCATATCATTGCCTCCAGGGGAA
TTGGAGTTACTAGATCATAATGGTGTGCGTGGAACAGTTGGGTATATAGCTCCAGAATAT
AAGCACCAGTTGATTATTACTCAAAAAACTGATGTCTACAGCTTTGGGATTCTTCTCTTT
CAGCTATTTACCGGAAAGAAAGTGTACGATATTATGAAAAGAGTGGATTCAAAAGAGAGA
ATAGATTTTGAATTAGACGCTAAATCCAATACTGAAGAGGATAATCCTATGGATAGAGTG
GATTCGACAATAGATTCTAAAACTCTTCCAATCAACTTTGTGGATCGTTATATTAATGAG
AGTAATGTAATGGATATTACGGATCCAGCTATCTTAGAAGAGCATGGAATTGAGATTCAA
CAACAATTGAAAGACTGCTTGAATCTTATTAAGAAATGCACAGCTGATAAGGGAGATGAT
AGACCATACATTATTCATGTTGCAAGGGAATTAGGTCGAATTGACAAGTGTTTCTGTGCC
CTCAGTACACTTGGTCAAAATTAAATGTTTATTTTAATTCCTCAACGTATTCATATTAGG
TTCCAACTTAAAGGTAATTCAGTTTATTTGTACAATCATAGTATTTATGTTGAACAAAAA
ATGATATCCGCAGATAATGAATTTTTATTTTTTTTTAAGCCTAAAGTTTGAGACTTAAAC
AGAGCAAAAAGAAAAGTCAAAATCTAAAGAGACAAAACAATATCTTAGTTAGCAGCAGTA
CTTTCCTAAAAAATCACGGAGGGAGATGAAGAGGCGTATAGGCATCGGCAACAGCGTCAT
CTTCAGTTAATCCAATTCCTCTGCAAAGCTCTGCTACCTCGCATAAACAAGGAATCTCAC
AAGTCTTTAAGCTCCATGAGGTGAAGTTCAACTACTTCACTCTCTTGAAATACTTTCTTA
TGGGCTACACTTTGTAGTACAAATTATTGTTCATGAGTACGTTTGCTGCCAAATCGATCG
TCTTGAGCAATTAGGATCTGGATAATGTAGACCAAACCTCGTGTAAAATTAGTTTTCC