Microarray Probes on PGSC0003DMT400034984

Probe IDChipProbe Sequence
CUST_31366_PI426222305 JHI_St_60k_v1 TAGAGTATCTAGGAAAAAACCTTCGAGTTTCCCCTCATCTTTGTTTTCTTCTTATTCATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034984

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034984 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G23230.1 +1 1e-35 125 75/133 (56%) Integrase-type DNA-binding superfamily protein | chr3:8289647-8290066 REVERSE LENGTH=139

Transcript Sequence (642 bp)

>PGSC0003DMT400034984 642 pgsc_dm_v3.4
ATAATCAACATGGATAGTAGTTCTTCTTCATCTTCTTCTAAAGGAAAAAAAATCATACAA
TTAGAGAAAGAAAATGGCAAGGATAGTAATGATTTGATCAAATATCGAGGCGTTCGGAAG
CGTACGTGGGGGAAATTTGCAGCGGAGATACGTGACCCAACGAGACAAGGCGCTCGCCAA
TGGCTCGGGACGTTTGATACGGCCGAGGACGCGGCGAGGGCCTATGACAAGGCAGCATTT
AATCTAAGGGGACATCTTGCTACTTTGAATTTCCCAAATGAGTATTATTCTAAGCTTAAT
GATCCACATTATTATAATTATCGTACTTCATTAAATGTTAATGTTCCAAGTAGAAGTTTA
GAGAGGGGAATCTCATCAATTGGTCATCAAGACAAAGAAATCATTGAGTTTGAGTATCTT
GATGATAGTGTGCTAGAGGAACTTCTTGGAGCAGAAGACCCAAAAAAGATGATAAGAAAG
TGAGGTTTATATGTTTTGTAATTTTTAAATTTTAAGTTATCATCGTGTCGAGATAAACCT
TTATTACTGGAGGAAAGGAATAGCGATGAATTCCTATATAGAGTATCTAGGAAAAAACCT
TCGAGTTTCCCCTCATCTTTGTTTTCTTCTTATTCATCATCG