Microarray Probes on PGSC0003DMT400034913

Probe IDChipProbe Sequence
CUST_31390_PI426222305 JHI_St_60k_v1 AGCCCAAAAGTCAACTGATGCATACCCTTTTGATATTCAACGTTTAGCACAATTGTGAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034913

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034913 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G45670.1 +2 0.0 527 244/358 (68%) GDSL-like Lipase/Acylhydrolase superfamily protein | chr5:18528600-18530164 FORWARD LENGTH=362

Transcript Sequence (1345 bp)

>PGSC0003DMT400034913 1345 pgsc_dm_v3.4
CTTTCTCTCAAATTTCTTCTTTTTAATTTTTTTGTTTTTATTTTTTGAAGGATTGATAAT
GTGTGGAGATTTAAAGATAATATGTGTGTTTTTATTAATGTTGAGTTTATTTGGGGATAA
TTATGGTACAAAAGGAGAACCACAAGTGCCTTGTTATTTTATATTTGGTGATTCATTAGT
GGATAATGGAAATAATAATGTGATTAGGTCATTGGCTAGAGCTGATTATTTGCCTTATGG
AATTGATTTTCCCGATGGACCAACTGGAAGATTCTCCAATGGTAAAACTACTGTTGATGT
CATAGCTGAGCTTTTGGGTTTTGATGATTATATTCCACCTTATGCAACTGCAAGGGGTAG
AGAAATACTTGGAGGTGTCAATTTTGCATCTGCTGCTGCTGGAATTAGAGAAGAAACTGG
CCAACAATTGGGAGGAAGGGTAACATTTTCAGGTCAAGTAAATAATTACAAGAACATAGC
TCAACAAATAGTGAGAATAATTGGGAATGAAAATTCAGCTGCAAATTATTTGAGTAAATG
TATTTACTCAATTGGAGTTGGAAGTAATGATTATCTCAACAATTATTTTATGCCCCAATA
TTATTCAACAAGTAGACAATTTACTCCTCAACAATATGCCAATGTTCTTATCCAACAATA
CACTCAACAATTAAAGACATTGTACAATTATGGAGCAAGGAAATTTGTGTTGATTGGAGT
GGGCCAAATTGGATGCAGCCCAAATGCTTTGGCCCAAAACAGCCCAGATGGAAGAACTTG
TGCTCAAAATATTAATGTGGCAAATCAGTTATTTAACAATAAACTGAGGGCACTTGTGGA
TAATTTAAATAGAAATACACCAAATGCTAAATTAATCTACATTAATGCTTATGGAATATT
TCAAGATTTAATTGACAATCCCTTTGCTTTTGGATTTAGAGTGACGAACGCTGGATGTTG
CGGAATAGGAAGGAACAATGGACAAATAACATGTCTACCATTTCAAAATCCATGCCCAAA
TAGAAATGAATATTTATTTTGGGATGCATTTCATCCAGGTGAAGCTGCAAATATAATTGT
TGGAAGAAGATCTTATAGAGCCCAAAAGTCAACTGATGCATACCCTTTTGATATTCAACG
TTTAGCACAATTGTGAAGAAAAAATAAATATGGTTATTATTAAATATATAAAAATTATAT
GTATTGCATTCTAACACTCTGTTTGTATCATTGTTACCCATTGTTTCATAATGTATTGTA
TTGTACTCTATTGTACTGTATTGTATGGTAGATACAATGTTTGGCTAGACTGTATTGTTT
GTTGTTGTTTAATAACATTTTTATT