Microarray Probes on PGSC0003DMT400034879

Probe IDChipProbe Sequence
CUST_31260_PI426222305 JHI_St_60k_v1 GTGCGCTCCCTAAACAAGCTGGTAATTGCTTAAAAATTACGATATAATCTATCTGTTTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034879

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034879 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G23250.1 +2 2e-19 82 35/45 (78%) myb domain protein 15 | chr3:8309492-8310624 FORWARD LENGTH=285

Transcript Sequence (425 bp)

>PGSC0003DMT400034879 425 pgsc_dm_v3.4
CTTCACTAAACACTTCAACCATTTTCTTTCTTTTTTTTCACTGAAACTGAAGAGTGAGAC
TTCTAATAATTTCTCTCACACATAAAAATTTGAAGAAAAAAAGAAGTTAAAGTTATTTCT
TTTTAGTCTGTTTCAAAAAAACGAGTGAGAAAAAAGAAAAATGGGCAGAGCACCTTGTTG
TGAGAAAACGAGCTTGAAGAAAGGGCCATGGGATCACGAAGAAGATCAAATTCTCATCTC
TTACATTAACAAAAATGGCCATAGCAATTGGCGTGCGCTCCCTAAACAAGCTGGTAATTG
CTTAAAAATTACGATATAATCTATCTGTTTCAATTTAAGTGACGTTATATTCATTTTGAC
TTTTGGGATGTTATACTATAATGTTAACTTCCTTTCTAAATTTGCAAATATTTTGACTAT
AAAAC