Microarray Probes on PGSC0003DMT400028923

Probe IDChipProbe Sequence
CUST_10296_PI426222305 JHI_St_60k_v1 TTCTGCAAATTTTGCTCTATAATGGCTTGCAGTGTTGCAGACTCTGGTTTCCTGTTCTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400028923

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400028923 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G30950.1 +1 0.0 662 305/367 (83%) fatty acid desaturase 6 | chr4:15057278-15059673 REVERSE LENGTH=448

Transcript Sequence (1966 bp)

>PGSC0003DMT400028923 1966 pgsc_dm_v3.4
TCAAAGTGCAATATATAGCCCCATGTGAATTGCTTAACCCCCATAGGCCCTTATAGCGGC
TTAGCCCAATCACTTCAACAGAAATAAGTTTTTTTGGTCCTTTCTCCTCCCTTCACTCTT
TATCTTCGATAAAGAACCAATTTTTATAATAAAGAACCATTTTTTACAGTAAAGAACCAA
TTTTTATTGGTTAAAGAGGTAAGGGGTGAGAAGAAAAGGGCTAAAGAACCAAAAAATCTA
AGTGGGGTTTTGTTTTTTTGTGAGTTCTTGTTCTGCAAATTTTGCTCTATAATGGCTTGC
AGTGTTGCAGACTCTGGTTTCCTGTTCTTGGCTTCCAAGAAAAGATCAGTTCATAGCACT
AGAATTGGGCAAATTGCTTCTACAGGAACATATTGTTTAAAGTGGGAAAGTCTACCTCAG
ATAAGCTCGAAACAGAAAGGCTGCTTAATTTACTCGAGAAAGAAAAATGTTATACAAGCT
GTTGCAGTTCCGATAGCACCTGCACCCTTAGACTCTGCAGAGGAGAGAAAACGATTAAGT
GAAAAATATGGTTTTAGACAAATTGGAGAACCACTACCTGATAACGTCACAATGAGAGAT
ATTACTGAGTCACTACCTAAGAAGGTATTCGAGATTGACGATGGAAAGGCATTGAAGTCA
GTTTTGATATCAGTAACTTCATACACACTGGGGCTCTTCATGATTGCCAAAGCTCCATGG
TACCTACTTCCCCTGGCCTGGGCTTGGACAGGAACAGCAGTTACAGGGTTCTTTGTAATA
GGACATGATTGCGCTCACAAATCCTTCTCAAAGAACAAATTATTGGAAGATATTGTTGGA
ACACTAGCCTTTTTGCCATTGATATATCCCTATGAGCCATGGAGGTTCAAGCATGATCGG
CATCACGCGAAAACAAACATGTTGCACGAAGACACAGCTTGGCAGCCTGTTTGGAAGGAG
GAGTTCGATTCAGTCCCTGCTCTGAGGAAGGCAATTATATTAGGTTACGGCCCTATTCGA
CCTTGGATGTCTGTAGCTCACTGGTGGCTCTGTCATTTCAATTTGAGTAAGTTCAGACCA
AATGAAATTGACAGGGTGAAAATAAGTTTGGGTTGTGTCTTTGCTTTTATGGCAATTGGC
TGGCCACTGATAATCTGGAAAACAGGGATTATTGGATGGATCAAGTTCTGGTTAATGCCA
TGGTTGGGTTATCATTTTTGGATGAGTACTTTTACAATGGTTCATCATACGGCACCCCAC
ATACCCTTCAAAACTTCTGATGAGTGGAATGCCGCTCAGGCCCAGCTGAATGGCACAGTT
CACTGTGACTATCCTAGTTGGATTGAGGTTCTTTGTCATGATATCAATGTTCATATTCCC
CACCACATATCCCCCAGAATACCAAGTTATAATTTACGGGCAGCTCATCAATCTCTCCAA
GAGAATTGGGGAAAGTACCTGAACGAGGCTTCATGGAATTGGCGTCTAATGAAGACAATT
CTGACAGTATGTCATGTCTATGATAAGGAGCGGAATTATGTTGCATTTGATGAAGTTGTC
CCTGAAGAAGCCCAGCCAATCACATTCCTTAAAAAAGTAATGCCAGACTACGCTTGATTA
ACGTGCACCTCAAAAGGTCAACTTTCACTTGCTTCATTCTTTGGGAAGGTATCCTTCCAA
TCCTTTTGGGTCCGGTCAAGCGGTCCAGTGCCCAAATGTCAAGTTCTCACAAATATTGTA
AGACTTGTTTTAACTCATCAAAGAGAGAAATATCTTCTCTAGAAGTTTCTTGGTAGTGTT
AGTGTAGTATACAATAATTTAAGTTTCTCGCGATTTTGTCTTCTTTTTTGATAAGTACCC
ATGAATAACATGTTGCTTATTTAACACCAAAGCTTCATTATATTCTTCTCCCTACGGTCG
ACTCAATATAATCTGCCAAGACTTATGTTATGCCAGTATCCTCAAA