Microarray Probes on PGSC0003DMT400028481

Probe IDChipProbe Sequence
CUST_51710_PI426222305 JHI_St_60k_v1 CAGAACTCAGTGTCTCACAATGAAATGCATTATGACAGAAAGGGAAGTTTGTAACTTTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400028481

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400028481 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G19390.1 +1 7e-139 436 297/766 (39%) Wall-associated kinase family protein | chr1:6700772-6703368 REVERSE LENGTH=788

Transcript Sequence (2623 bp)

>PGSC0003DMT400028481 2623 pgsc_dm_v3.4
ACCAAAACATTTAAAAATCACAATATGGATCCCACTTGTAAAGTTATTACTTTTTTCGTT
TGTCGAGAAGTGGGGAAGCCTTAGCAGGTCCTATTTCAAAAGTATAATGATGTTTGCAGA
ATTTTGTGTCATCATAAGATATGATTCAACCAGAGAATGAGGCAGTAATACATACCAGTA
TACATGAAGATGCATATAACCATGTGGTCATTTTTCATTCTTCTGATGGGGATGCTTTCT
AAAGAAACAACCCAAGTTTCAGCTATAAGAATATGGTCATCATCAGCAATATTATCTTCA
CAAAGGCCGCGATGCCCAGAAAGATGTGGCAACGTAACCATTCCTTTTCCATTTGGAATA
GGAAAAGAGTGTTGCTTCAATGAAGCATTTGAAGTGAGATGCGATAACAACACTGCTTTT
ATAAATGATTTGTCTGTGCAACACATATCAATGGACTCCATCACTATTTATATTACTTTT
ACTCCTCTCCACTACAACAACTCATCTGGAAAGAACATTTACAATGATTATCTTCAAGCA
AACAGCGACGAGTATTTCAGTATTTCCAACAAGAACAACTTAGTAGCCATTGGTTGTGAC
ATTTATGCTTATGCCAAAGATTTAGACACCGGTAGTAGAGACAGCATTGTAAGTCAATGT
GCTTCTTTCTGTGGCAACTCCACTTATAATGTTTCATCCTCTTCACCTTCATCATCTTAT
TGCACTGGGAATAGCGGTTGTTGTCAGTCTGAATTATCAAAAATAGTACCAAGAGACTTC
AATATGTACATACAAACAATTAACACGGCGGAAACATCTTGGACAACTAGCAATTGCAAC
TATTACTTAGTTGTGGAAAAGGGCAGTTCTGAGTTTGACTTCACTCAGTTACGTGGTAAG
TGCAAACAAGATGATCATTATGAAGGAAGGATGGCGCTGGACTGGGTAATTGGCAATCTT
AGTTGCAACAAAGCCACAAGAATGCCAAAATATGCATGTACAAAGAATAGTAGGTGCATC
GATGATACTACTAGACCTGCTGGGGGATACCGATGCGATTGCTCTTCTGGTTATGAAGGC
AACCCTTACCTCCTTCATGGATGCCAAGACATTGATGAGTGTGCAAGTCCAAAAAGGAAT
CGTTGTCCGAACAATACTCGCTGTGTTAATACTCTTGGCACTTACCATTGTGACTCAAAT
AATGTGAGACATATGCTAGCTAAACAACTCTCCATCGGTATTGGAGCAGCAATTATTTTT
GTGATCCTGGTAGCAGTTTGTCTTTGGCTATGCAAATGGCTCCGGAAGAGGGAAGAAAAC
AAAGCTAAGCAAAAGTATTTCAAGAGGAATGGTGGATTGCTTTTGCGACAACGTATTTCC
TTAAATGGAGAAAGTAGTGGTGGCTCTTTGCCAAAGCTCTTTTTGAAGGAGGAGTTGGAG
AAAGCAACAGACAATTTCAATGAAATTCGAATTCTTGGTAAAGGAGGGGCTGGGACTGTT
TACAAAGGAATGTTATCAGATGGAAGCATTGTAGCTGTGAAGAAGTCCAATGCAGTGGAT
AAAGATCAAATTGGACAGTTTATAAATGAGATACTCATACTCTCCCAAATAAATCACAGA
CACATTGTCAAGGTACTTGGTTGTTGCTTAGAAACTCAAGTCCCATTATTAGTTTATGAG
TACATCTCGAATGGAACCTTGTCATCCCATATTCATGGAAACCTCAGTCACAGTTCTAAC
CCTACTGTCTCAAAGTCTGAGTTGGATGATCAGATTCTTCCGCACCCAGTAATAATATTA
TCGTGGGATCATCGGGTGCGAATTGCTGCAGAAATAGCAGGGGCACTATCTTACATGCAC
TCATGTGCTTCTACTCCCATTCTTCACAGAGATATAAAATCAAACAACATATTACTAGAC
GATAATTTTAGAGCAGTGGTTTCTGATTTTGGACTATCGAGATTATTGTCTGTTGACAAG
ACTCATTTAACAACAATGGTAGGGGGTACATTTGGTTACATAGATCCAGAATACTTCCGC
TCAGGTCAACTTACAGACAAATGTGATGTCTATGCCTTCGGTGTAATTCTTGCAGAGCTT
CTAACAAGTCAAAGAGTTGTCACTTCAAACCAACCAGAAGATCCAGGTTTGGTTATCCGT
TTCACATTAGCATTGAAAGAAAACTGTATAATTGAGATTGTAGACCCTGAAATTGTAAAA
GAAGTTGAGGATGAACATGTGATTCCTGCTGTGGCCAAACTTGCCAAGAGATGCTTAAAT
TTTAATGCAAGGAGAAGGCCATCCATGAAGGAGGTGGCAGCCGAACTTGAACAACAAGGA
AAAATGAGGCAAGATATGCCTCATAATGAGAGTTTTCAAGATAACATTTCACCAAAAAGT
GAAAGTTCATGTAGTCATACTTCTGATTGTACCGAAGAAGATCATCAGAACTCAGTGTCT
CACAATGAAATGCATTATGACAGAAAGGGAAGTTTGTAACTTTTATAACTTCAACTTTTA
TCTTTTGTAATTGTAATGTCGAAGTAATTGCATGTATGGACACATAATCAAATGAAGATT
AGCATGATTTGCATTAATATTTAAGTCGTATATATGATTTGTT