Microarray Probes on PGSC0003DMT400027895

Probe IDChipProbe Sequence
CUST_6910_PI426222305 JHI_St_60k_v1 TAAGTTGCCACTTGCCGTCCCTGACACCAATGTAATGCTTTACGATTACATGATATAGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400027895

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400027895 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47160.2 +1 4e-67 210 105/213 (49%) RING/U-box superfamily protein | chr3:17360238-17361879 REVERSE LENGTH=257

Transcript Sequence (672 bp)

>PGSC0003DMT400027895 672 pgsc_dm_v3.4
GCATTGGCTCTTCCCCGGGATCTCGATGGGGATTGTGTTCAGATGAAAGTTTCCTATGGT
TTTCTCGCCCCCTTCTTGCTATTTCTGATAGAATGGATGGACTATAGTTGTTTAGATACT
CTAGCTAGTTGCTTAGGACTCCTTCACATTCTTGTTTATAAGGTTTATGTTGATGGAATG
CCAACAATGCCCCCACAAGAAAGGAAGGCCACAATTAGAGAATTCTACGCCATTATATAT
CCTTCACTAAAGCAGCTGGAGGGGAATTTAGTGGAATTAATGAAGGAGAATACTAAAGTA
ACTCAACTCTTGAACACTTCAAATGGAAGAGTGGAAGAGAAAAGACAGTCATGTAAAAGT
ATTCCGGGAGAAGAAGAAGAATGTGGTATATGCATGGAGAGTGGCTCCAAGATAGTTTTG
CCTAATTGTAGCCATTCCATGTGTGTTGGCTGTTTCCACGACTGGTACATCCGGTCTCAA
TCATGCCCTTTTTGTCGAGGTAGTCTAACGAGAGTAAACTCCAGAGACTTGTGGGTTCTA
ACTAGTGACTGTGATGTGGTTGATAGCACCACTCTAGAGCAGGAGAATGTAAGGCGGTTC
TACCTTTATATTGATAAGTTGCCACTTGCCGTCCCTGACACCAATGTAATGCTTTACGAT
TACATGATATAG