Microarray Probes on PGSC0003DMT400027553

Probe IDChipProbe Sequence
CUST_32353_PI426222305 JHI_St_60k_v1 CCGTCTGTGCATATTTTACTAGGTTAGCACATATCAATAAACAAAACAGACAACAGACTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400027553

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400027553 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G27461.1 +3 6e-80 258 163/360 (45%) unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr1:9537948-9539012 REVERSE LENGTH=354

Transcript Sequence (1737 bp)

>PGSC0003DMT400027553 1737 pgsc_dm_v3.4
TTTTAAGGAGGTGTCTTTTCTTTTCTGATACTACTTTTTCATTCATAACCGAAGGGAGAG
ACAGCTAGGAGTAAGGCTTAGGGTGTGATAAGTGTAAAGCATGCATGCAAGTTCAAAACT
CTCTTGTAATCCCACATGTCCTTTTTTTGTTTTAAAGTAGCTCAAACACGTACCCACCGT
ATGTTTCCAAGTGTCATTTCAACCTGTTCTCTTCTTTCATGTTTTGCCCTTTTCTTATTG
GCTTATATCACCCTTCTTATACCTCTTACTCTAGTCCCACTAATTTTCCCTCAACTCTCC
TCTCTGTTTTTCTGAATTTGGTTCTTTTTTTTGGTTGTTGTTAAGAGGAAAAGGGTTCTT
TTTTATTCAAAAAAAAAATGATGCAGACTTTGAATCCTTACCCTTCAACCTCAAAAACAG
CTGAGATCATGGCTAGGTATAGGCCAATAGCACCAAAGCCTGAGGCTCCAACTAGCCCTG
TTTCTGAGGATAATCCTACTGGATTACCCCCAAATATTCAAAAGTCTCCTTTCTTGAGGA
ATGTATGGCCTCAATTGCAAGCAAGGCCAACAAGGACTAGGAAGAGAGGAAGGACTGCCC
TTGGTCCACCTTCTATGAAAAGAGCCAGAGCTAATTACTTTCCTGCTGGCCAATTTCCTA
CTTATCAGCAGGTGATGGCTGCTTCTCCTTCTTATAGACCAAATGTGCTTCCCCAGTTCA
CTTTAATCCCAAATCTTCTCCCTCTTAAATGTGGTTTGGGTACCTCTGTTACAACTCCAT
CAAATTCCATAACACTCCCTCTTATGGCTTGTACTACCACTACTCTTCCTATGCTAGTAG
AGAAAAACTCTGGAGAGGAAATTAGAGGAATCGATTTGAATTTGGCAGCTGATGGCCCTG
AAGAATTAGATTTCATGCCCCAATTGCAAGGTCCCAAGACCCCTGGCCCGGGTGTTATAA
CCCCGCAGCCAGTTCGCCCAGTTGGGTCAAGTATTTCCATTGGGTGTATCAATGAGGAGG
AGGCTCCAGAAGGTGGTGGAACAAACAAAAAATTTATGAAGAAACCAGAGGAGGTGGAGG
AAGAAGTTGAAGCAGAGGCTTTGCCAGCTGTAATATCGGACTCGAATAACAAAGTAAGGC
TCACAAATGCAGCATACAAAGAGATGGTGGGTCAACCTGAATGTTGCTGGCTGGACTACA
TGGTTGGGAATGCATGCAAGAGAATTGGTGGGGAAGTGATACTTGAGTTCTTGGATTCAT
CTTGCAGTGTGCCAATGTCATCTGATGGGTTCAATTGTTGGGTGAAGATAGAATGGGGAG
CTGCACAAGGGAAAAAGAATTCAGTCAAAGCTTTCTGCAATGCTGTGAAGTTAGCTTGCC
AGTCCAAAGATTATGTCTTTGAGTGGAGGTTCCATACCACAGATGATGATGCTCCTGCAT
CAGCTGCTTCCAATAATTAAACAGTTTTTTTATCAATTGTATATACAGTTTAACTAGTTT
AAATGTTGTAAAATGCCGGTTAAAAACTTATGCAATATAGTAGCAGCATATAGAAAGTAG
GAAAATTAGGGTAGTTCAATTATGTTTAATAGTTATTTCCAGCTTAAGAGTATAAAGCTA
TGTGTCAATTGTCAAGTGTATACGTCTTCTTTCTTTTTGTTCTCCGTCTGTGCATATTTT
ACTAGGTTAGCACATATCAATAAACAAAACAGACAACAGACTAAAGTTTCGAATGCC