Microarray Probes on PGSC0003DMT400025820

Probe IDChipProbe Sequence
CUST_7602_PI426222305 JHI_St_60k_v1 GTATCAATGGCATATGCTAAACCATCTTGTTCATGGATTGGATTAGGAAAGAAGACAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025820

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025820 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G76240.1 +2 1e-78 248 152/311 (49%) Arabidopsis protein of unknown function (DUF241) | chr1:28602949-28603875 REVERSE LENGTH=308

Transcript Sequence (1149 bp)

>PGSC0003DMT400025820 1149 pgsc_dm_v3.4
ATTTAGATCTACTTGTTGTCTCCTTTATAAACACTTCTCAACTGTCCAACTCTTCACAAA
AATTATTTTTTTCCCCTTTTCTGTCCAAAAAATGGGAAAAGAAAAAACACTATCAAAATC
AAGAACAATGGCTCCTCGAATGGTGGCTAATTTCCGCAGATCTCTTTCTTTCCCAAATCA
CCCAAACCATTCAAATAAACCCAAAAAATCCTTCCATGTCCGATCTGCTAGTCTACCATG
TCGATCTCATCCATTAATTTCTCAGCTCAAAGATGATTTAAACGAGCTCAAATCATGGGC
TATTAAGCCTGAAAATCGAACTTCAAATTGGATTTGTGATGGACTCAATCAACTGAAAAT
TGTTCATGAATCTCTTGATGATCTGCTTCTTCTTCCACAAACACGCGAATCCTTACATGG
ACATTCTGATTTGGTCGAGAAGCTTCTAGATGATTTCCTTCACTTCGTCGACGTTTATGG
AATCTTCCAGACCTTGATACTCACTTTCAAGGAAGAACATTTAGCTGCTCAGGTAGCTGT
GAGGCGTAAAGATGAATCTAAGATTGCTTCATACGCGAAAGCATTGAGAAAAATGGCTAA
GGAAATGGATAAACTCGCGTTCAACGTACAATGTATAGGGAAATATATTGTACCTCAACA
AACTATACCAATACCTGATGGAGATGCAGAGTTAGCAGAAGTGATGAAAGACATAATAGA
AGTAACACAATTAGTTTCAATTGCACTTTTTAATGGACTTGGAGTATCAATGGCATATGC
TAAACCATCTTGTTCATGGATTGGATTAGGAAAGAAGACAAAAAAATTGAAAGAAAATGA
AGGAATTGTGGAATTTGTAGAAATGGAATTGGAGAATTTGTTGAGAAAAAATAAAGGAGA
TGAAGAGGTGAAAATTGTGACTAAAAAAATGCATGAATTGGAAGATTGTATTTGTGGGAT
TGAAAAATGTGGAGAGAAAGTGTTTAGGAGTTTAATTAATGCTAGAGTTTCATTGCTTAA
TGTATTCACACAATAGAAAAATAAGGTAAAAGGGAAATTAAAGATGATGCATACATGTAT
ATTTTGCTTAAATGTTTTTTTTAACTATGTATTTGATTTGTTATTGTTATAAAGTTGATT
TGATTGACG