Microarray Probes on PGSC0003DMT400025122

Probe IDChipProbe Sequence
CUST_30506_PI426222305 JHI_St_60k_v1 GAAATTAAGGCCTCAGATGATCAGGTTGATGATTTTTAGTATGCCTTTCATTCAAGAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025122

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025122 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G18220.1 +2 4e-90 281 142/311 (46%) Drug/metabolite transporter superfamily protein | chr4:10078768-10080109 FORWARD LENGTH=344

Transcript Sequence (1409 bp)

>PGSC0003DMT400025122 1409 pgsc_dm_v3.4
TTCCAATTGTCAGAATGGTCACGGTCACGATACACCCAGTGGTGCAAATAAAAGCAATAG
AATAATTTAGGGGAGCAAAATGCTGATGGACTTATAAATTATACTTTGTGCTTCTATAAG
TTATCACAACGGTTATCCAAATTTTATGGCGCGTGTTAGCATGGAAGGAGCACATGAAAA
GCTGCTGCATCTCACTTTTGAAGAAGCAGAGTCATCTGAAAATGCAGATAACAGCAGTGT
TCAATCAAGTAAATTTATACTATGGCTTCAAATATTTATCTTCACATTTTTTACTATTGG
TGGTCAAGCAGCTGGCACTCTGTTGGGCAGAGTATACTATGAACAAGGTGGCCAAACCAG
ATGGATTGCTACATTGGCACAAACTGCTGGATTCTCAATTCTCCTGCCTTTCATTTGCTA
TCCTTCACCCAAAAACCACAATGAAGATGAACTAACCATTCACCAGCCTTCTATATTTGT
TCGCGCTTCGGTTTACATCTTCCTTGGTTTATTTCAAGTAGCAAACTCTATGTCATTTAC
AGTTGGAGTACAGTACCTTCCTGCCTCAACTTATTCTCTAATTTCCGGTTCTCAATTGGC
CTTCAACGCGATCACCTCCTTCCTCCTCAACGGACAAAAAATCACTGCAATTATACTCAA
CTCCATCGTGCTACTCTCCTTTTCATCCTCTGCTGTTATTTTCCAGAATGAGACAGGTGA
TAGCGGAGAAATATCTCAGAAATCTCTGCTAATCGGATTTGCAGCTACCACTTTCGGGTC
TCTAGGTTACGCTTTACAGTTCTCATTTACAGAACTCGCATTCCAAAAGGTATTCAAAAG
TAGCACATTAAAAGAAGTCATGAAAATGTCGTTTTTCATAGGTTTTTTCGTGACGATTGC
TTCGTTAACGGGGCTTTTCGCGAGCGGTAATTGGAGGCATTTGGAGAAGGAAATGAGAGA
GTACAGAACAGGGAAATCATCATATGTTACAAACTTAGTTTGTTCTGCTATTGCTTGGCA
GTTATATGCTCTTGGATCATGTGGATTGGTTTTTAAGGCATCTTCTTTGTTCTCTAATGT
AGTCATCAATTTGGGAACTTCAATTGTGCCAATTTTTGCAATGGTGTTCTTGAAAGATAG
AATGACTGGATTGAAAGTGTTTTCATTGTTATTGGGATTATGGGGATACACATCATATAT
ATATCAACATTATCTTGATGATTTAGAGGCAAAAACAAGTGAAATTAAGGCCTCAGATGA
TCAGGTTGATGATTTTTAGTATGCCTTTCATTCAAGAAACTTAAATATCTGAACAATTAG
CTTTGTAATTATGATTGATAAGTTCAATATGTAAAGTTATAGCTTATTGTTTAATCATGT
AAATTTCAAGATTTCCGTGTAAATTGAAC