Microarray Probes on PGSC0003DMT400023654

Probe IDChipProbe Sequence
CUST_9243_PI426222305 JHI_St_60k_v1 CTTGCATGCTCTTATTTGTCTGCTCAATTCCTTCATGAAGGTGGATGCTATGCTGGACAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023654

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023654 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G50420.1 +3 5e-26 108 48/59 (81%) O-fucosyltransferase family protein | chr5:20530453-20532635 REVERSE LENGTH=566

Transcript Sequence (936 bp)

>PGSC0003DMT400023654 936 pgsc_dm_v3.4
CAAACATCACATGTTTCTTCTCTTAGATTGTACAGTTTCTACCATCAGTTGTATGTAGGA
TCTTAGGGAACTTATTGGTAGAAGAACAAGGTTCATGTAACTTATACATAGTATGGTTTT
TCGATAGCTCATGTTATTATTCCTTATAGGGGACAGGCAGCACAGAAGCAGACTCCTGTA
AATGAAGTCTGCTTTTCTTTAATCTTATCTTGCATTCTCTTGTTAAATTTTGTTTGTTGG
TCTTGCATGCTCTTATTTGTCTGCTCAATTCCTTCATGAAGGTGGATGCTATGCTGGACA
AGACAATTTGTGCCATGTCTAGTGTGTTTATTGGATCATCAGGGTCTACTTTTACTGATG
ATATTTTGCGGCTACGAAAAGACTGGGGATCTGCTTCGCTTTGTGATGAGTATCTATGCC
AGGGTGAACTGCCAAACTATGTCGCTGATGACGAGTGAAGCATACTTCATCTTGTACTCC
TCAAGCTCATTCTGCTACTGAACAAGTTACTATGCCTGAAGAAAATGAAAAATTGTGTTG
GAGTAAAGAGTGATATCTGTTGTTATATTGTCTGTTACATACTTGTAATCTCGATTCTTT
AGCATAGATGGCCTATTTGGCCAATTCTTTTGGTCTGTATTCTAGTGTATAATATTGGTT
AGCAGAGTGACAATGTTTTGTTCTGTGTATCTGTTTTATCTCTTACCACCAGTTTTAGAG
TTTGTAGGTTTGCATATTGACACATACACTTCTCAATAGTTGAATTTTTTCAGGATGAGA
AAAGATAACTTCACTTTCTTGTGGTAGAAAATGGAGTTGTTTCCTTTCTCTTTACTAGTT
CTTGTTTTTGTGTTTTAAGTATACTGAGGGAAAGCTGAGGCAAATATAAGTGGATCAGAA
TCAACTTGGTTCAGAGATGGAAAAAAAGAAATCGAC