Microarray Probes on PGSC0003DMT400021429

Probe IDChipProbe Sequence
CUST_47385_PI426222305 JHI_St_60k_v1 CTGCTTCGGCTGCCATATCTAGATTCTTCCATAATTCAAAAATTAGCTTACATAACAGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400021429

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400021429 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G46295.1 +1 2e-09 52 24/55 (44%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G06475.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:18779904-18780119 REVERSE LENGTH=71

Transcript Sequence (471 bp)

>PGSC0003DMT400021429 471 pgsc_dm_v3.4
GTTTCATTCCAAGAGGGAACAATGAAAATGAAAGCTGGTGGCTATTCCTTCTCGTTCAAG
AGACTAAGTAAGAAGGCAGTCGCCGGAACTGTTGGTTCTGAAGTAGGTACTCATGCCGGA
GATCATCATGATTCCTTAACTCAGCCCCCACCGCCGCCGCATCGGCAGTCGTCGTTACGG
TGGCGATTCAAAAATATGTCTTCTGGATTGAGGTGGAAGAGTAAAAGGCTTTACAAATTG
CGATACTGGTTCGTTGATTGCTTACTCTTCAAAATCATTTCTGTATTTGAAGCCATTTTT
CTCGTCTCTGCTTTGGCTTTCTTCTACCTCTGCTTCGGCTGCCATATCTAGATTCTTCCA
TAATTCAAAAATTAGCTTACATAACAGTGAAGAAATGTTGAAATTAGATTTATTTTGTTG
AGGTTTATGTAATGATTAATCGTATAGAGAAAGTTAGTGGACTAATTTGCG