Microarray Probes on PGSC0003DMT400021384

Probe IDChipProbe Sequence
CUST_47382_PI426222305 JHI_St_60k_v1 GATATAATGGAACTGTCCCGTCAGATTATTTTGAAGTTGACATGCATCATGAAAATGAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400021384

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400021384 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G46330.1 +2 0.0 1213 641/1164 (55%) Leucine-rich receptor-like protein kinase family protein | chr5:18791802-18795407 FORWARD LENGTH=1173

Transcript Sequence (4028 bp)

>PGSC0003DMT400021384 4028 pgsc_dm_v3.4
TTATGTACTCCTAGGTTTCGAGTAGGAGACGAAATTCTTGTTGTCTTTTCTTGTGTGGGG
GTACATACAACTTGTTCTTTAACACGGAGCATCCTAGATTAGAGGCATGCTTGGTATTTT
GTAACAAATTCATAGAATGCAAGTCATTTTCCTTGGTGTGAATGGATGACTAGTTGACTG
CCACTGAAAGCAGTGATTCACTGTACGATTCACTAAGAAATGTGTATAAAGGCTTCATTG
TCAGCATAAGTTTTTTCAGTGAGTGAAGCTTCTTTCTTTTGAAACAATGATGTCAAAGAC
AGTTGTATATGCATTAGCCATATTTTCTATTACCTTTCTCATACCTCTGTCATCTGGGCA
ACATCCAAGCTTTGAAGTTGAAGTTGCTGCTTTGAAAGCTTTCAAGAGCTCAATCTCTGA
CGACCCTTTCGGTGCACTTGTGGATTGGACGGATGCAAATCACCATTGCAACTGGTCTGG
AATCATATGTGATCCTTCTTCAAGCCATGTCATCAACATTTCGCTTATTGAGACGCAGCT
CAAAGGCGAAATTTCTCCGTTTCTAGGAAACCTCTCCAAACTCCAGGTTCTTGATCTAAC
TTTGAATTCATTTACTGGAAATATCCCACCCCAGCTGGGGTATTGCACAGACCTGGTTGA
GCTCGTTTTTTACCAAAACTCTCTTTTTGGTGAAATTCCTGCCGAGCTGGGAAACCTAAA
AAAACTGCAGTATATAGATTTTGGAAATAACTTTCTAAATGGGAGTATACCTGATAGTAT
ATGCAACTGCACTGAATTGTCGTTAGTAGGCTTCATCAACAACAATCTCACAGGCAAATT
ACCGTCTGAAATTGGTAAGTTGGCCAATCTTCAGTTGTTTGTAGCTTATACAAACAATTT
GGTTGGTTCTATTCCTACCTCCATTGGAATGCTTACAGCTTTGCAAACCCTTGATCTGAG
CGAAAACCAGTTATCTGGACCTATACCATCAGCAATTGGCAACTTGTCAAGTTTAGGAAT
TCTTCAGTTACATCTCAACTCTCTTTCTGGGAAAATCCCATCTGAACTTGGCCTCTGTAT
CAATCTTTTTACCTTGAACATGTATACTAATCAATTTACTGGAAGCATACCTCCTGAGCT
TGGAAATTTAGAAAACTTGCAAGTGCTCAGATTGCATAACAATAAGTTGAACTCCAGTAT
ACCTGCCTCAATATTCCACCTGAAGTCATTAACTCATTTAGGACTCTCACAGAATGAACT
AACTGGTAATATTCCTCCCGAGTTGGGATCTTTAACGTCACTAGAAGTGCTTACCCTTCA
CTCAAATAGGTTATCGGGGGAGATCCCATCAACTATAACAAACCTGGCAAACTTGACATA
TTTGTCTTTGGGCTTTAATTTATTGACTGGATCACTTCCATCGGAATTTGGGTTACTCTA
TAATCTGAAAAATCTAACTGCAAATGATAACCTCCTGGAAGGATCTATTCCATCGAGCAT
AACAAATTGTTCTCATCTTCTTGTTTTAACCCTCGCTTATAATAGAATAGCGGGGAAAAT
ACCAAATGGGTTGGGGCAATTGTCCAATCTTACATTTTTGTCTTTGGGATCAAACAAAAT
GATGGGGGAGATTCCTGATGATCTCTTCAACTGTTCAATGCTTGAAATTCTAGATCTGAG
TGATAACAATTTCAGCGGGAAACTCAAATCAATGATTGGCAGACTCTCTAAACTTCGAGT
TTTAAGAGCTCGTACTAATTCATTTCTTGGGCCAATCCCACCAGAGATTGGTAAACTGAG
TCAACTCGTGGATTTAGTGCTTCACGAAAACAGTTTCTCAGGTGCGATACCACCAGAAAT
TTCAATGCTTTCAAACCTTCAGGGTCTTTTGCTATCTGACAACAAGCTGGAAGGTGAACT
TCCTGTGCAGCTTTTTGAGCTCAAACAGCTCAATGAACTCCGGCTGAAGAACAATAATTT
CTTTGGTCCACTACCGCAACATATATCCAAACTAGAATCACTGTCGCTCATGGATCTGAG
TGGAAATAAGCTTAATGGCACAATCCCAGAGAGCATGGCGAGCCTCCGCAGATTGATGAC
CGTAGATCTTTCACACAACCTTCTTACCGGAACTATTCCCAGAGCAGTACTTGCCAGCAT
GAGAAGTATGCAACTTTACTTGAACGTTTCCAGCAATTTGTTGCACGGAGAGATCCCAGA
TGAGATAGGCGTGTTAGAAATGGTTCAAGAGATTGACATGTCAAATAATAATCTGTCAGG
CAGCATTCCCAGATCCCTAGAACGCTGCAAAAACTTATTTTCACTGGACCTATCAGGAAA
CATGCTCTCTGGTCCTGCTCCAGGTGAAATTTTCACCAAATTAAGAGAGCTTGTGTTCTT
GAACCTCTCAAGGAACAGATTAGAAGGTAGTCTTCCTGAAATAGCAGGATTATCACATCT
TCGCTCTCTTGATGTTTCACAAAACAAGTTCAATGGAATCATTCCCGAGAGATTTGCCAA
TATGACTGCATTGAAATATCTCAACCTTTCTTTCAACCAACTTGAAGGTCACATTCCAAA
GGGGGGTGTATTCAACAATATAAGGTCGGAGGATTTACTGGGAAATCCATCTCTATGTGG
AACAAAGTTTCTCAGTCCATGCAACATAAAAAGAAACCGAACAAGTTCTCATGGTTTTTC
CAAGAAAACCTGGATCATACTTGCAGCACTTGGATCTGTTTTCAGTCTCATTCTTCTTGT
CCTGGGAATAATTTTATTTCATCGGTACATGAAGAAGAAGAAAAAAGTGAATGACGCGGA
GGATACAAATCCAAAGTATACCGCAGCATTGAGCCTCCAGAGATTTTATCAAAAGGATTT
GGAACATGCTACCAATAATTTCAGTCCGGAAAACATTATTGGAGCCAGCAGTTTAAGTAC
TGTGTACAAAGGTACACTGGAAGATGGGAAGATTGTAGCAGTTAAGAAGCTGAATCACCA
GTTCTCAGCAGAATCTGGTAAATGCTTTGATAGGGAAGTCAAGACTCTGAGCCAACTCAG
ACACAGGAACCTAGTTAAGGTGCTAGGTTACGCTTGGGAAAGCAAGAAGCTAAGGGCTTT
AGTTTTAGAATACATGGAGAATGGGAACTTGGACAACATGATTTATGGTCAAGTGGAGGA
TGACTGGACGTTGTCCAATAGGATTGATATTTTAGTTTCAGTTGCAAGTGGACTGTCATA
CCTGCATTCAGGCTATGATTTTCCAATAGTGCACTGCGACATGAAGCCTTCAAATATTCT
TCTGGATAAAAATATGGAAGCACATGTGAGTGACTTTGGGACAGCTAGGATGTTGGGTAT
TCATCTCCAGGATGGGAGCAGCATATCATCAGCATCCGCATTTGAAGGAACTATTGGTTA
CATGGCGCCAGAGTTTGCATATATGAGGAAAGTGACCACAAAAGTAGATGTATTCAGCTT
TGGTGTCATTGTGATGGAGATCATTACAAAAAGAAGGCCAACAAGTCTTACCGGAGCAGA
TGAATTACCAATGACTTTGCATCAAATTGTTCAGAATGCCCTTGCGAATGGCATAAACAA
GCTAGTTCAGATTGTGGATCCTAATCTAGCTTCATATGTCTCCAAGAAACAGGATGTACT
AGAGGGACTTCTTAACTTGGCTTTGTCCTGCACCTCTGCTGATCCTGAAGATAGACCTGA
CATGGAACAAGTTCTGTCTTCTCTTTCAAAGCTAAGTAAGATGGACTGCATGCCTTCACA
TTTGGTAAAAGATTAAATTTGATGTAGAAGAAGCTGGAATATCATCACTCTTAAAGTGAA
CCACCACCAAGTTTCTCATGGGGCTAATGGAACTAGTTCATAACTTAAAATGTATTTACT
ATTTAAATAAATTTTCCGTATTTCAAGCCATAAATGATCTCTCGAGTATTCCTGCTTTAC
TAGAGAGATATAATGGAACTGTCCCGTCAGATTATTTTGAAGTTGACATGCATCATGAAA
ATGAACAA