Microarray Probes on PGSC0003DMT400020700

Probe IDChipProbe Sequence
CUST_29052_PI426222305 JHI_St_60k_v1 GCACAACGGAAAAAGGTCAGAAATGCTCTTAATTTTTCATTAAACACGCGACCTTTATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020700

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020700 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G19184.1 +3 1e-57 192 110/220 (50%) AP2/B3-like transcriptional factor family protein | chr3:6637555-6639035 FORWARD LENGTH=277

Transcript Sequence (1141 bp)

>PGSC0003DMT400020700 1141 pgsc_dm_v3.4
GCTCAAAAGAACTCTTTTTGTTTTCTTCCATCTCTTGTGTAAGATTACCTTTTGTTTTCA
TCAAATCGAAAAGAAAAATGGTGAAATATGAGGATTTGCGGAAGCAGAGATTGGAAGAAA
ACAAGAAAAGAATGGAAGAACTTAATCTTCCTCTGCTTACTCAAGCTCTCAAAAATTCAA
CTTCCCCCAAAACTACTCCTATGAAGAAAACAAAACCTCGGATTGTCGGAACAGAGCTAG
TTGCTGTGCGAAGATCACCTCGTGTAGCTAAAAGCCCTGCTCCTGAATACAAAGAAGTGA
TTCATTATGAAAGAGTGATGATACCAAGAAGGTTGGCTACACCAACGAAGAGGGATAGGT
TGTTTTTTGCGTATGCTTCGGACGAAGAAAGAGCTGCTTCGATAGAGAAAGCTGAGAAAC
TTGAAGCAAGTCTTGGATCAGAGTATCCTATATTAGTTAGACCAATGCTTCCCTCTCATG
TTTCTGGAGGTTTTTGGCTGGGTCTCCCATCGAATTTCTGCAGGAAGAACCTTCCAAGAA
GAGATGACACTATCACCTTAATAGATGAAACAGGAGAAGAATGGCCAACTGTATACTTGG
CTCAAAAATGTGGACTTAGTGGTGGATGGAAGAGGTTTTCTGTGGATCATGACTTGGCCG
ATGGAGATACAATCGTGTTTCATTTGATTCGTCCAACAAAATTCAAGGCATATATCATAA
GAGTAAACAATGCCAACGAGACTGCAAGTACTGAAATCTCAACCTCAACCTCAACCTCAA
GCAGTGAAGCCTTTTGAAAATCCAGGAGAAGAGAATGTTGCTGCTACGCGTTATGTGGCT
TCTCTGTCTCATATTTTGTCCGACATGTTTTTAGTAGATCTAAACAACAACATTGGAGGT
GATTTTGATCTAGAAACAAGTCATTGGTAGATTAGTACATAAAATCCAGGAATGATAGTT
TTGATGTTGCAAGTTGAACTTGTCCTCCAAAAAAATGCCAATTTTAAGCCTAGTTATTAT
GTTTTCGCATATACTTTCTCCATTGTTTAACATTGCACAACGGAAAAAGGTCAGAAATGC
TCTTAATTTTTCATTAAACACGCGACCTTTATTTTAAAGGCTATTTTGGTCCCATAAATA
T