Microarray Probes on PGSC0003DMT400019730

Probe IDChipProbe Sequence
CUST_34164_PI426222305 JHI_St_60k_v1 CAATCATCTGAAAGTGAGCAACAAGGCATCAAGTCATCACTCTCTGGTGTCAATGGCTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400019730

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400019730 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G41430.1 +2 1e-32 120 75/169 (44%) dehydration-induced protein (ERD15) | chr2:17269736-17270314 FORWARD LENGTH=163

Transcript Sequence (876 bp)

>PGSC0003DMT400019730 876 pgsc_dm_v3.4
GATAAGACTTCATACGTGTACGAGTCGCTTCTGTAGTTGAAAGATATTTTCTTTTCGTTA
AGATAGCAATTTTGGAGAAAGAAGAATGGCTTTAGTTTCTGGAGGAAGGTCATCAACACT
GAATCCGAATGCACCTCTCTTCATCCCATCTTATGTGCAACAAGTGGAGGACTTTTCACC
TGAATGGTGGAATTTGGTAACAACTGCAACATGGTTCCGCGATTATTGGACGAGCCAGCA
TCAAGGAGAGGAATATGGCGATGATGATCTTGGGTTTGCTGGAAATGATGTTGCTGACTT
GCTTCCCGAAAACATTGATCTTGATGTCGATGAGGATATTTTGAATATGGAAGCTCAGTT
TGAAGAATTTCTTCAATCATCTGAAAGTGAGCAACAAGGCATCAAGTCATCACTCTCTGG
TGTCAATGGCTTACCCAAGGGTTCTGAGGCACTCGTAAGGACACTGAGCATGCCAAAGCC
AAAATCTCCTATTGAGCCTCCAAAGTTGTACGAGAAACCAGCAAAGATTGTTAGCCCAAA
GAACAGCCTTCGCCGCATCCAGCAGCCCCGCTAAATGTAGTTTAGCTTAAGCAAAAGTTC
TTTGTTTGTAGTTTGGGTGTATGTTAGTTCTTAATCTGCAGCTTTTAATCTTTGAAAAGC
AGCAATTGAGAAAGTTTCAAGAGTCTTTAGTTCTTGTTATCTTTTGTATAGAGCAAGGTA
GAGGTGGCACTTTTGTATCTAGCCTTGTTCATAGTTTTAGTATATCTTTTCATCAGTTTT
TTAACTTTGTAAACATCAAAACTTGTCCAAAGTGAAAAAAAATATATGTAAAAATCAGTT
GACAAAAAGAGCATGTCTTTTGAGTCTTATTTCTTG