Microarray Probes on PGSC0003DMT400019318

Probe IDChipProbe Sequence
CUST_47814_PI426222305 JHI_St_60k_v1 TCAATGACTAAAGTGAGTGTGTGTGTGTGAGAGAGAGACTTTTGAATTAGACAAGATTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400019318

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400019318 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G25620.2 +3 0.0 799 436/653 (67%) ABC-2 type transporter family protein | chr3:9316677-9319505 REVERSE LENGTH=672

Transcript Sequence (2353 bp)

>PGSC0003DMT400019318 2353 pgsc_dm_v3.4
CAACATTTGAAAACTCTCTCTTTGTGGGTCTCTCCCTATATCATGTCTCTAACACACATT
GCTTCTTCTCGTGCTTATTTTTTATCACTTTAAAGCTCTCATCTTCTCTTTTCTTCATTT
GCATGTGATTTTATCTCTTTTCTCATCAACAAATTAAACCTTGAACAATTTGACAAATTT
TTGAAGCTTTAAGAGTTTTAAAAATGTTGCCTCATGATCAAGAGAATAGTAGTAACATCC
ATGGTGGTTCGAGTAATGTTCTTGTACGTGCTCGAATTGATAGCATCTCACTTCAGATCG
AACCAAATGGTCCAACGTGTAACGTTAGTCCTCGTGTGAACGATGATAGAGTCTCGGATC
ATCAACAATCACATCATGCTAAATTATCAATTCTTCGTGAATCTTTACACCCCGTTACTC
TTAAGTTTGAAGATGTTTCATACACTATCAAATTGGAAAGCAACAAAAGGGGTTATTTTT
CTTCACATCAACAAAAGCAAACTAGAATGATACTTCAAAATGTCATGGGAATAGTTAAGC
CTGGTGAACTTTTGGCCATGTTAGGTCCATCAGGAAGTGGTAAAACAACTCTCCTAACAT
CGATAGCCGGTCGATTGCACGGTAAATTCTCCGGTACCATAACATACAACGATCAACAAT
TTTCGAGCTCAATGAAACGAAAAATTGGTTTCGTGACACAAGATGATGTGCTATATCCTC
ATTTAACCGTCCTCGAAACGTTGACATACGCTGCTTTGTTAAGATTACCTAGTAAATTAA
CAAATCAAGAGAAAATTGAGCAAGCAGAGTTAGTTATTATGGAATTAGGGTTAACAAGAT
GTAGAAATAGTATGATTGGTGGACAATTATTTAGGGGAATTTCAGGTGGAGAGAGAAAAA
GAGTGAGTATTGGACAAGAAATGTTAGTGAATCCAAGTTTATTGTTACTTGATGAACCAA
CTTCAGGTCTTGATTCGACTACAGCTCAACGTATCATGTCAACGTTACGTTGGTTGGCTA
GAGGAGGTCGGACCGTGGTCACAACGATACATCAACCTTCTAGTACGTTGTTTAGAATGT
TCGATAAAATTATCGTCTTGACCGAAGGTTGTCCGATTTATTATGGGAAAAGTAGCCTTG
TTATGGAATATTTTGCATCGATTGGTTACGCTCCTGGATTCAATTTCATGAACCCTGCTG
ATTTTCTACTTGATCTTGCTAATGGTATTACACATGATACAAGGCATGATGATCAACATG
AACTTATTATGAAACAAGATCAATCTGAAAATCAAAATGCAACCAAACAGTCCTTAATTT
CCTCTTATAGAAAAAATATTTATCCTTTATTGAAAGAGGAAATTAATCAAAGTTGCAATC
GTCCGATTCGTTCATCATCAACAAGTCGCGACGATCAATGGACCACAAGTTGGTGGTTGC
AATTTAAGGTTTTGCTTGGTAGAGGACTTAAAGAAAGAAAACATGAAGCCTACTCTGGTC
TAAGGATTTTCCAAGTGATGTCTGTTTCATTTCTGTCTGGACTCCTATGGTGGCATTGTA
AAACTAATCATATAATGGATCAGGTGGGATTGCTATTTTTCTTCTCAATATTCTGGGGAT
TTTTTCCTCTGTTCAGTGCCATATTTGCATTCCCACAAGAGCGTCCAATGCTCATAAGAG
AGCGTTCGTCTGGCATGTATCGCCTTTCGTCTTACTACTTTGCACGAACCGTGGGTGATT
TACCTATGGAACTTGTACTTCCAACAATCTTCGTAACAGTAACATACTGGATGGGTGGTC
TAAAGCCAAAATTTGTCACATTTATACTGACCCTTTTGATCATACTTTTAAATGTGCTAG
TGTCTCAAGGACTTGGCCTAGCACTTGGTGCAATACTAATGGATGTGAAACAAGCCACAA
CATTATCTTCAGTGTTGATGCTTGTGTTTTTGCTAGCAAGTGGATACTACATTCAACATA
TTCCTATTTTCATTAATTGGCTCAAGTACATCTCATTTAGCCACTATTGTTACAAACTTC
TACTTGGAGTACAATATTCAAGAAATGAGGTTTATGAATGTGGGATTGGGAAATATTGTG
AAGTATTGGAATTTCCACCTATTAAGTATCTTGGAATTGACAATTTGGTACTTGATGTGG
TGGCATTGGTTGTTATGTTGGTGGTGTATAGGCTTTTGGCTTATGTTGCTTTGAGGTTGT
GGCATCAATGACTAAAGTGAGTGTGTGTGTGTGAGAGAGAGACTTTTGAATTAGACAAGA
TTTGTATTAATTTCTTTAAGTTTATTAAATAAAATATTAAGAAGTATAATTATTAACCTT
GACAAGAAAATTT