Microarray Probes on PGSC0003DMT400018674

Probe IDChipProbe Sequence
CUST_30605_PI426222305 JHI_St_60k_v1 CTCCATGTTTGATTTGTGTGACCAGTATGTTTCGACATGTTTTGGATATATTTGGATTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400018674

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400018674 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G48690.1 +1 7e-63 209 135/328 (41%) alpha/beta-Hydrolases superfamily protein | chr3:18037186-18038160 REVERSE LENGTH=324

Transcript Sequence (1395 bp)

>PGSC0003DMT400018674 1395 pgsc_dm_v3.4
TTTCTCTATAAATAAACTAGACTTTGCTCCATCCATATCCAGACCAAAATACAACATTTC
CATACTCTGCTTTTCTAACATTTGCACACTCTGTTTTCAACTATGGCAGCTTCCGACAAC
AACAATGACGTTGTCACTGATTTCTTCCCATACTATCGACTCTACAAAGACGGTCGAGTA
GAACGTTTCTACGAACTTGCTGGTATACATGAAGTTCCACCATCGCTGGAAGATCCAGCG
ACTGGTGTATCATCAAAAGACGTGAGCATCTCTGCTCACGTCTCTGCTAGACTCTACCTT
CCAAAAAACACCGCACCCAATCAAAAACTCCCCGTCTTAGTGTATTACCACGGCGGAGGA
CTTGTATTAGGATCCGCATTTTTCAAAACAGAGCATTGTTACCTCAACTATCTGGTTTCC
GAATCAAATTGCATAGCGATCTCTGTAAATTACCGTCTTGCCCCTGAGCATGACATCCCG
ACAATCTATCAGGATTGTTGGGATGCTCTTCAGTGGGTCGCTTCACACTCTGTTTCTGAT
ACAATTAACAAAGACCCGTGGATTGAAAACCATGGTGATTTTAACCGCGTGTTTGTAGGG
GGTGACAGTGCTGGAGGTAATATAGTTTATAATATGATCATGAGAGCGGGGAGAGAAAAA
TTGATCGGTGATGTGAAACTTTTGGGTGCAATACTTGCATTTCCTTATTTGATGATACCA
TCTATTGAAAACTATGACAAAGGTTTGTCTTATAAGCTTTGGAATACCATTTGCCCGCTC
TCTGAACGGGGAAATGATAGTCCAATGGTTAATCCAGTCTCGAAAAAGTGTCCTAGCTTA
TCGACGCTAGGATGCTCGAGACTTTTTGTGTGTACAGGAGAGAAAGACGAACTTGTCCCA
GGAGAAGTTGCGACAAAATTCGCCGAAGCTGTGAAGAAAAGTGGATGGAAAGGGGAAATT
GAGTCCATTTTATTTGAAGGTGAAGGTCATTGCTTTCAGTGTGAGAATCCTCAAGCTGAG
AAATCTAAAGATTTGATCAAACGTATAGTTTCTTTCATCCAACGCGATTAACATGTGTTT
TTAGAAATTATTATTATTTGCACGTTTCCTCGGAAAACAACCTCTCTACTTCTATGAGGT
ACAAATAAGGTCAGCATATATTCTATCTTTCACGTACTACAATGTTGTTATTGTTGTTGT
ATATTATTAATATTAATAGTAATAAATCTTGTTATCTTAAATTAGTGTTCTGTGGTGTAG
ATGAATTGTTAGAAGCTGTAAAGTGTTTGATATTGTTACATCTAGCAAATCAACTTTATC
TGCTCCATGTTTGATTTGTGTGACCAGTATGTTTCGACATGTTTTGGATATATTTGGATT
TGAATTATTGATTTT