Microarray Probes on PGSC0003DMT400018461

Probe IDChipProbe Sequence
CUST_17019_PI426222305 JHI_St_60k_v1 GAGATGGAGAGGATTTTGGCTCTAATATATATGGAGTTTGCGCGTGATTGCTTAGCTTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400018461

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400018461 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G28085.1 +1 1e-23 91 47/76 (62%) SAUR-like auxin-responsive protein family | chr2:11968182-11968556 REVERSE LENGTH=124

Transcript Sequence (366 bp)

>PGSC0003DMT400018461 366 pgsc_dm_v3.4
ATGTCGAAGGATAGAACAAATGGGAAGAACGAAAAGAAAGGTATAGTGAAGAAATTAAGA
AAGAGTCTTCTATTAGGGAAGAAATATTCGATGGAAGATCAATCGGAAAACGAGTCGAGG
GACGTACCGGAGGACGTGAAGGAAGGGCATTTCGCGGTCATTGCGATGGACAACGATGAG
CTCAAGAGATTTGTAGTGCCATTAAGTTGCTTAAGACACCCTTCATTCTTGAGGCTATTG
GAACAAGCTGCTGAGGTATATGGTTTTAATCATGAAGGTGCACTTACATTACCATGTAGA
CCTAGTGAGATGGAGAGGATTTTGGCTCTAATATATATGGAGTTTGCGCGTGATTGCTTA
GCTTAG