Microarray Probes on PGSC0003DMT400018218

Probe IDChipProbe Sequence
CUST_17994_PI426222305 JHI_St_60k_v1 GTACAATAAGTGGGTCCACAGCTAGTAGTCCAATAAATGAGTACTTCCTATTTAATGTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400018218

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400018218 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G78860.1 +1 5e-85 269 145/300 (48%) D-mannose binding lectin protein with Apple-like carbohydrate-binding domain | chr1:29646168-29647499 REVERSE LENGTH=443

Transcript Sequence (1184 bp)

>PGSC0003DMT400018218 1184 pgsc_dm_v3.4
CCAATCTCAAGAAGCAAATGTATCATCTAACAAACAAGCTAAAACAACAAACTAAACATG
TCTTCTTCCTGGCCTACTACACTTCTTGCCTCTCTCTTTCTTTTCTCCCAAATATTTTCT
TGCATTGCTCAAGTTCCAGCAGAAAACACCTTTAAATTCGTCAATGATGGCGAATTAGGA
GATTATGTTGTAGAATACAGAGCAAATTATCGCGTTATTAGTATTTTCAATAACCCATTT
CAGCTCTGTTTCTACAACACAACTCCTAATGCATGGACATTAGCATTGCGAATGGGCACT
GTCCGTTCTGAATCACTCATGCGTTGGGTGTGGGAAGCAAATAGGGGAAACCCCGTTAAA
GAAAATGCGACATTCACGTTTGGAACTAACGGAAATCTCGTATTGGCGGATGCTGACGGT
CGAATCGCTTGGCAGACCAACACGGCCAATAAGGGGGTCACCGGGTTCAAATTGTTACCT
AACGGTAACATGGTGCTACATGACTCCAAGGGTAAATTCGTCTGGCAGAGTTTCAACTAT
CCCACTGACACATTACTAGTGGGCCAAACTCTCCGATTGTCCGGCCCGAATAAGCTTGTG
AGCCGGGCCTCGGTGAAAAAGAATGCAAACGGGCCTTATAGCTTGGTGGTGCAGCCGAGA
TTGTTCGCTGTCTACAAGGGAAACAAGGTAGACGTGGAATTAGCTTGGTTCGATTATGGG
AATAACACGTTGGAATCGATAAAATTGAATAGTGGGAATCAAAGATTGAAATTGGATTAT
AGATTTGCAAAATCAACACAGAGAAGTTCACATGTGATGGCATTTACTAAATACAACACA
ACATTGACATATCTTAGACTTGAAATTGATGGAAATCTAAAGGCCTACACTTTTGTTAGA
GATGAAGAAGCAGATGAATTCCGTTGGAAAGTAACTTACAGTAGGATTTGAAACGTCTAA
ATCTGTATACACATTATCCTTTACGAGCAAATTTCACGGGTTATATTATTATTGTTGTTG
TTATATTGTTGTAAACGTAGCTCTATAAGATAATGATTAGTGTGTCCAGTACAATAAGTG
GGTCCACAGCTAGTAGTCCAATAAATGAGTACTTCCTATTTAATGTTAATTATATTTTTC
TTTTTCCCTTTTTGAAAAAATATTATGTTTTGGTTGAATTAAGA