Microarray Probes on PGSC0003DMT400017966

Probe IDChipProbe Sequence
CUST_33242_PI426222305 JHI_St_60k_v1 GCAAATCCTTTTCTGTCAGAGATTGGTCCAGTGACATTGATAACAATGACGACAATGACA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017966

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017966 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G01930.2 +3 1e-160 344 233/316 (74%) Major facilitator superfamily protein | chr3:319289-321488 REVERSE LENGTH=584

Transcript Sequence (2184 bp)

>PGSC0003DMT400017966 2184 pgsc_dm_v3.4
ATGAAATTTCAATCATAATCTAGTGTTACTTGTGCCTTATCTTATCACCAATAAGCCCTG
CTTGATTGGAGTTGAGGCATAGTACCAAAGTTTGCACTTGGATATCGATATAAACATAAT
CAATACTCATTCTGCTTCTCTCAGATAGTTGGTCATTGCCTCAGTCCCTATATTGCTGAC
CATCATAATGAATTATGTCTTATCCATAACATAAATTGGGCATAACTTATTAGTGTCAAC
TAGAGTGCAAAATTGTCACACATTCCTTGTTTTCTCTAACAGTTGACTTAAGTTTAACCA
TTTCTCTGCAGATGTGCATTCTTATATTTGTAGGAACAAATGGTGAAACCTACTTCAACA
CAGCAGCTTTAGTCTCTTGTGTGCAAAATTTCCCGAAAAGTCGTGGTCCTGTGGTTGGAA
TTCTTAAGGGATTTGCTGGCTTAGGTGGTGCTATTTTAACTCAGATATATGCAGTAATCC
ATTCCCCGGATCACGCTTCACTTATATTTATGATTGCCGTTGCACCAGCAATGGTGATTA
TAGCTCTCATGTTTATAATCAGGCCTGTTGGAGGCCATAGACAAGTTAGGCCTTCTGATG
GTTTAAGTTTTTCATTTGTTTACAGTATATGCCTCCTTTTAGCTTCTTACTTAATGGGAG
TTATGATTGTTGAAGACGTTGTTGATGTTAGCCAAAATGTTATTGTAATCTTCACAGCTA
TTCTATTTGTTATCTTGATAATCCCTATTGTGATCCCTATCTATTTGAGTTTCACTCAAG
AGCCAAGAGTAGTACCAGAAGAAGAGGCACTTCTATCTCAGTCAGGCGATCAAGGTCCTG
GCAGATCAGAACACGACGATGGTCAAGAAATTATATTTAGTGAGGTTGAAGAAGAGAAAC
CGAAGGGAGTAGACTTGCTTCCTGCTTTAGAAAGGCAGAAAAGAATCGCGCAGTTACAAG
TGAGACTAGCACAAGCAGCTGCAGAAGGAGCTGTGAGGATCAAAAGAAGACGAGGTCCTC
GTAGGGGAGAGGACTTTACTTTAGTCCAGGCTTTAATAAAAGCAGATTTCTGGCTTATGT
TTTTCTCATTGCTTTTTGGTTCTGGATCTGGTTTGACTGTCATTGATAACTTGGGACAAA
TGAGCCAATCTTTAGGATATGAAAACACACATGTATTTGTTTCGATGATTAGCATATGGA
ACTTCCTTGGCCGTATTGGAGGTGGATACTTTTCTGAGATAATCGTCAGGTATTAACTTA
TCTTTACATGAATATTCATATCTCATAAATCTCTCACACGACCTTGTCAAACAGGGATAA
TGCATATCCAAGGCATGCAGCTATGGCTATTGCTCAAGTTGTGATGGCCTTTGGTCATTT
CTTCTTTGCTATGGGTTGGCCTGGAGCTATGTATATTGGTACTCTTTTGGTTGGACTTGG
TTATGGAGCTCATTGGGCGATTGTGCCAGCTGCTGCTTCTGAATTGTTTGGGTTAAAGAA
TTTTGGGGCTTTGTACAATTTCCTCACTATTGCCAACCCAGCTGGTTCATTAGTATTCTC
AGGTCTTATTGCTAGTAGTATATATGACAGGGAAGCTGAAAAGCAAGCTCAACAGCCCCA
TGAAGGACATTTGAATTTGGCGTCAGTTTTGACAAGTTTTTTAAACATGGATGAACCTCT
AAAGTGTGAAGGTACCATTTGCTTCTTCTTGACTTCCTTGATAATGTCAGGACTCTGCAT
TGTTGCAGCTGTTCTAAGCATGATTCTGGTGTACCGCACAAAGACAGTGTACGCTAATCT
GTATGGAAGATCTCGTACGTAATGTATCCTCGAAGGATAGAAATATAAGCATCCTGAAAA
AAGACATTGTCTGCCAATTCATATTTCCACATATCATTATAATGTGACACTGGAAACCAT
CACCAGAATACTTCCAGGTGAGAGCAAACGACGAAGAAGACAATAGCCTGGTTTTGCTGT
TGCAAAAGCATTCCTTGGTTGAGTGAAATAATATTTGTATTGCAAGTCATTTCTGTATAT
TTGTAATTTCTCAATCTTCAAGTTGTTAAATTTTTTATTGTCAACCACCATTAGTAAGAG
CGTTGATTGATTTTTTGCTAATTGGCAAATCCTTTTCTGTCAGAGATTGGTCCAGTGACA
TTGATAACAATGACGACAATGACA