Microarray Probes on PGSC0003DMT400017664

Probe IDChipProbe Sequence
CUST_13511_PI426222305 JHI_St_60k_v1 GAGAGAAGGATATAGGGTAGTTTCCAGGATATTCTTCATTGCAGATAACATACAATTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017664

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017664 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G13700.1 +1 3e-71 231 115/164 (70%) polyamine oxidase 1 | chr5:4420222-4422974 REVERSE LENGTH=472

Transcript Sequence (978 bp)

>PGSC0003DMT400017664 978 pgsc_dm_v3.4
CATCATTATGTGCTCAAGAACTGCTCCTAGCTGTTTGTTAATGCTGATCTGTTTTCATGT
CATCAGCACATGGAAAATGCTTATCCGGGCTCCAATATGCTGGTGGTAACCCTGACAAAT
GGTGAGTCAAAACGTGTGGAAGCTCAATCTGATCAAGACACATTAAGAGAAGCAATGGAA
GTGTTAAGAAACATGTTTGGGCCTGACATTCCCAATGCCACCGACATATTAGTCCCACGT
TGGTGGAATAATCGGTTTCAGCGTGGTAGCTACAGTAATTACCCCATATATGCAAATCAT
CAACTCGTCCATGATATTAAGGAACCAGTGGGACGGATATTTTTCACAGGAGAACACACA
AGTGAAAAGTTTAGTGGCTATGTCCATGGAGGCTACCTTTCAGGTATAGACAGTAGCAAT
GCTTTACTTGAAAAAATGAGAAGGGATGATGGATGGAAGAATGAGAGTCAAGCTTTTCTG
TTAGAACCATTGCTAGCATTAACAGGATCTTTGACATTGACACAAGCTGAGACTGTATCA
AGTCTCCACAAATGTGATATTCCGCGACAACTCTTCCTTAGTAACAGCAAATTGGCAGAG
GCTATCTTATGAGACTAAATGAACCTCTGGATATAATTTACTCTGACAGATATCCATCCA
ACCACTGATAAACTCGATTTGCTGGAGTCTGACAAAAAAGTCCTTTGTTCCATTAACAGA
AAAAAGGAGCAAAGAAACTTGAGAGAAGGATATAGGGTAGTTTCCAGGATATTCTTCATT
GCAGATAACATACAATTGTTATTAGGAGTAAAGTCATAGAAAGGTATCATGCAGTACTAA
TGATATTCAGTACATGAAAAATAAGTAACAAGATGACTGATTATGTTCAGTTGCTTTTCA
ATCAATTATTATTGCCTAATGTAATCCTCAAGTTTGTATATCAAAACATAACTTTGGTTT
TTTGGTTTTCTGGTTTTC