Microarray Probes on PGSC0003DMT400017556

Probe IDChipProbe Sequence
CUST_13504_PI426222305 JHI_St_60k_v1 GTACCTAATCTTGAAGAACTAGAGGAAGAATCAACGTCCGAGATTGAACAAGATTTAATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017556

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017556 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G57670.1 +1 4e-88 265 111/124 (90%) C2H2-type zinc finger family protein | chr3:21370936-21373121 FORWARD LENGTH=383

Transcript Sequence (432 bp)

>PGSC0003DMT400017556 432 pgsc_dm_v3.4
ATGCATATGTGGGGACATGGATCTCAATACAGAAAAGGTCCAGAATCTTTAAGAGGTACA
CAACCAAGTGCAATGCTAAGGCTACCATGTTACTGTTGTGCACCTGGTTGTAAACACAAC
ATTGATCATCCAAGAGCAAGGCCATTAAAAGACTTTAGAACACTTCAAACACATTACAAG
AGGAAGCATGGTGCTAAACCTTTCATGTGTAGAAAATGTGGTAAGCCATTTGCTGTGAAA
GGTGATTGGAGAACTCATGAGAAGAATTGTGGTAAGATTTGGTATTGTATTTGTGGATCT
GATTTTAAGCATAAGAGGTCTCTAAAAGATCATATTAAGTCATTTGGACGCGGTCATGGC
GCGGTTGGGGTACCTAATCTTGAAGAACTAGAGGAAGAATCAACGTCCGAGATTGAACAA
GATTTAATGTAA