Microarray Probes on PGSC0003DMT400016330

Probe IDChipProbe Sequence
CUST_46461_PI426222305 JHI_St_60k_v1 GATTATGTGATTTTGGAAATGTTTTGTGTAATGTTTTCGTGGGATTGGGATATGCAAGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400016330

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400016330 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G64430.1 +2 5e-67 231 191/471 (41%) Octicosapeptide/Phox/Bem1p family protein | chr5:25762540-25764081 REVERSE LENGTH=513

Transcript Sequence (2023 bp)

>PGSC0003DMT400016330 2023 pgsc_dm_v3.4
ATAAAATCCAGCCTCTCTTATTTCTCTGCCCTGTTTTTCTACCTTAATACTCTGCTTCTT
CAACTTCCCATGGCTTCTCTAAATTCCTCCATTTCTTTGTAACACTACCAAAGAAAAACC
TCAAATTCTCAAAAATTATCAATCCATGGAGAACTACTCTTATTCTTCATACCCAGATTC
TGTTAATTCATCCCCACGTTCCCGCGAAATCGACTGCGAAAACGCTTCATGGGATGATCA
ACCACCTTCTTCAAATTCAAATTACAAGGTCAAATTCATGTGCAGTTATGGTGGTAAAAT
ACTACCGAGACCCCATGATAATCAGCTCGCTTATGTCGCCGGTGAAACTAAAATTCTCTC
TGTTGATCGGAATATCAGATTTTCGAATCTTGTTGCTAAGCTTTCGTTGATTTCTGATTG
TGATGTTTGCTTTAAGTATCAATTACCTGGTGAAGACCTTGATGCTTTGATTTCAGTAAC
TAATGATGAAGATTTAGAGCATATGATGCTTGAATATGATCGTCTTTATAGGGGTCCTGC
TAAACCGGCGAGGCTCCGGTTGTTTTTATTTCCGTTGAGTACTCCGGCGACGAGTACTTT
TGGTTCTACTGACTCGAAAACTGAGAGTCAGTGGTTTGTTGATGCTTTGAATTCTGTTCA
GTTGCAAAATTTGGATGTGAATTCACCGACGGCTGTTTCGTCGGCACCGGCGCCGGCGAA
TAATCCGGATTTTCTGTTTGGGTTGGATAAAGGGCAAGTTCAACAACAACAACCTCCACC
GGTGAAGCTACAAGACCCAACTCCACCACCGCCGGTGCCGGAGGTTTTTGTTAAGGATTT
TGCTGGTTCCGATACTGGATCGGAAGATCGGCATATCATCGGAGAAAATGTTATCTCGCC
GGCGGATTATCAGAGACAGATTCATGAAATGCAGAGGCTGCAGCAGCATATTTCTAATCA
AGAACAAGCTATGTATAACAGGAAGATTGAGGAATCTATTCCGCGAATGTATCCCGGAGA
ATACTACCAGCAAAAAGCTCCGCCGCCGCAACAGACGGCGGTGCCGGTGACGAATTCGGC
CAGTTTTTGGCAGGAACGTCATATGACTACTGGACCATACCCTGCATCATCAGTGCAAAC
TGAACAGCCTGTATATATAGTTCAAACGCCCGCCGGAGTTTATCAAACTCCGGCTATGCG
ACCGGTGACCAACCAAATGGGTGGTCAGGCTTATTACGGCATGCAGCGCGTGATGCCGGA
GGTTTACCGGGAACAGCCGATGTACGGCGGAGTTCCACCACAACCAACAATTCAACAGCA
GCAAATGGGAGGAGCTTACACGTCGGAAAATATGGGGATGGTGCGGCCACACGCGCCGCC
AGAGCCAACATATACACAAGTTGGGTATGACAGTGTAGGGAGACAGGTGTATTATACTGC
ACCGGCGGGTGTTATGCAACAGCAAATGCAGCATCCAGCAGTGGCAGGTTGGCTAACATC
AATTAACAATTGTGTGTTACATTAGCAAGTGTTTAATTTCTTAAACTTAGTTTAGATTTG
TGTTTAATCAAACATTAATCACTTGCATATCCCAATCCCACGAAAACATTACACAAAACA
TTTCCAAAATCACATAATCCTATTTTCACTTAATTAAAAATTTAATTTAAAAGCATGAAA
GACATTAACGATAAACATCAAGGCTTGCCAATAATTCTACCATCTGGATTCAACGCGCCA
CCACTCTGCCTCCCATCCCCCGCCGCTGCAGCGGCGGGGGATGGGAGGCAGAGTGGTGGC
GCGTTGAATCCAGATGGTAGAATTATTGGCAAGCCTTGATGTTTATCGTTAATGTCTTTC
ATGCTTTTAAATTAAATTTTTAATTAAGTGAAAATAGGATTATGTGATTTTGGAAATGTT
TTGTGTAATGTTTTCGTGGGATTGGGATATGCAAGTGATTAATGTTTGATTAAACACAAA
TCTAAACTAAGTTTAAGAAATTAAACACTTGCTAATGTAACAC