Microarray Probes on PGSC0003DMT400015942

Probe IDChipProbe Sequence
CUST_27868_PI426222305 JHI_St_60k_v1 CATCATACCACCACGACCTTTATAAGGGTAGTTGGTGGTGGTATAAGGACAGTAAAATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015942

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015942 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G58290.1 +1 8e-33 118 56/69 (81%) regulatory particle triple-A ATPase 3 | chr5:23569155-23571116 FORWARD LENGTH=408

Transcript Sequence (240 bp)

>PGSC0003DMT400015942 240 pgsc_dm_v3.4
ATGTTGTTTTATCCTGATATTGGAGGATGCGATATACAAAAGCAGGAAATTTATGAAGCC
ATCGAGTTACCTCTGAGTCATCATGAGTTGTACAAGCAGATTGCTATAGATCCTTCCTAT
GGCGTGTTGCTCTATGGTCCACAAGGCACTGGAAAAACCATGCTTGCAAAGGTTGTAGTA
CATCATACCACCACGACCTTTATAAGGGTAGTTGGTGGTGGTATAAGGACAGTAAAATAA