Microarray Probes on PGSC0003DMT400014261

Probe IDChipProbe Sequence
CUST_52717_PI426222305 JHI_St_60k_v1 GGTTAATCTTGGTTGACTTTTAGTATATGTTGATGCGTTGTTGTGATTGAAGTACCTTGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014261

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014261 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G57870.1 +2 1e-25 99 43/50 (86%) sumo conjugation enzyme 1 | chr3:21428831-21430110 REVERSE LENGTH=160

Transcript Sequence (592 bp)

>PGSC0003DMT400014261 592 pgsc_dm_v3.4
TACAAAGACAGCAGTTTCATTATCTTCTTAATCCTATTTAGGTAATTCTGTCACCATTAA
TCTCCACCGTTGAATCTGCCACTCACAACTACTTTACAGGTTCAAGACTCGTTTCACTTC
TCCCTTTTTTTTTTTGTCCTTTTAAAAGGGGGGGGTGGGCAGCCAAGAAGAAACACAACT
CTTCTGAGAGATTGTTCACTGTTCATTTAGTTATTAACCTTGAACAACAACAATGTCGGG
AGGGATTGCTCGTGGTCGTCTTGCTGAGGAGCGCAAAGCTTGGAGAAAGAATCACCCCCA
TGGTTTTGTTGCTAAGCCGGAGACACTTCCAGATGGGTCAGTGAACTTGATGATTTGGCA
CTGCACTATCCCTGGTAAAGCTGAGGTGTGTTTACATTCTTCGCCTTTGTTCAGTTTTCT
TTCTTATGAATTGGGAAAGATTGGTTCTTTAATTGTTTGTGAGGATGAGGGGAAACCATG
GGAAGCCTTCTTCAGTGAACACCCATTTTAGGGGTTAACCAATTTGGTTAATCTTGGTTG
ACTTTTAGTATATGTTGATGCGTTGTTGTGATTGAAGTACCTTGGTTTATGG