Microarray Probes on PGSC0003DMT400013992

Probe IDChipProbe Sequence
CUST_24684_PI426222305 JHI_St_60k_v1 GTCTTCTCCAATTATCAATACCACTTCATCTTCTCAAGATCATGTGAGTTTAGATCTACA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013992

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013992 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G41940.1 +1 2e-48 165 110/263 (42%) zinc finger protein 8 | chr2:17507556-17508329 FORWARD LENGTH=257

Transcript Sequence (888 bp)

>PGSC0003DMT400013992 888 pgsc_dm_v3.4
CTCTTTGCCCCCTCCAACTAAAGAAATATAGACAACACACTCCTTTCCTTATAGCTCCTT
GTAATATCCTCTTTTTTTCTTCCAAAATACTCTCTCATGGAGAAGACAGATAGAGAAACT
CGTGATTTCATGAACGTTGAATCCTTCTCTCAGTTACCTTTTATCCGTCCAGTTCCAGCA
CCGCCTAAAGAAAAGACCGGCATTAGGCTTTTCGGAAAAGAATTTGGAGCTGGTACTGGT
GATGCTGAGGAATCAGAATCGGAAACCATTGAAGCAGAAGAAATTATAAAAGAGAATTCT
AATACTAATACTAATACTAATCGGAAATTTGAATGCCATTATTGTTGCAGGAATTTCCCA
ACTTCACAAGCTTTAGGAGGACATCAAAATGCGCATAAGAGAGAACGTCAACATGCTAAA
CGAGTTCATCTGCAATCTGCAATGGTACATGGTGCAGCAGCTGAAGCAAATAATATTTAT
GGTATAATGAATTATCGCGTTCCCAATTATCATCATCATCATCCATCAACATGGATGACA
AACAGTACTACCAGATTTTATGGAAGTCCTTATAACTCTTCTCATCATCATCATCATCAT
CAAACTCCGCCTATTAATGGAAGTCCATTAGCGTTATGGAGAATTCCAGCAGCACCAACT
TATAATAATTCTTCTAATTATGGTCGTCCAGTCGTGTTTACTGCTAATAATCATCAGGAT
TTCAAGTCTTCTCCAATTATCAATACCACTTCATCTTCTCAAGATCATGTGAGTTTAGAT
CTACATTTGTGAAGAAACTAAATAGTTTGGAATTTCCAATTTAGTCTAGCTAATTAATTA
AAATTCTTTAATCTTCTTCAAAGCTTTTGTTATTTCAGCAACTTTTAA