Microarray Probes on PGSC0003DMT400013135

Probe IDChipProbe Sequence
CUST_49849_PI426222305 JHI_St_60k_v1 GTTGCTTCGGGTTTCAGTTTTGCTAATTAACTAACTGACAGCAGTTTTTAGCTGGATTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013135

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013135 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G10020.1 +1 1e-123 375 251/464 (54%) Protein of unknown function (DUF1005) | chr1:3269939-3271732 REVERSE LENGTH=461

Transcript Sequence (1659 bp)

>PGSC0003DMT400013135 1659 pgsc_dm_v3.4
GGCGCACCTCTATATGCATACGTGCCCACAGCTCATTCCGCACGCACGCCTATGCACCTT
TCTTAATATATATTCTTACCCTCAATCCCACTTTCTTCCCTAAAATTCCTCAATCTTCTT
CTTCATCTGAGTAAAAAAAAACAAGAACCGAAAGGACTAATGGATCCATGTCCGTTCGTC
CGTATTGTAATCGGAGGTTTAGCCTTGAAGTTCCCTTCTGAATCCAAAATACCACCCAAT
AGTTCAACTTTTGATTGTAAAATCAAGCTTAGAGGTTGTTCGGCGCAATCAACGACCATC
CCAGCGTTTGTTCAAGAAAGAGAAGCGATCGTGGATAATAGAATTCATGGTTGTTTTAAT
TTTAGTAAGTCAGAGCTTGTGAAATTCGTTGAGAAAGGAAAATCCAGTTGTTTAAAGATT
GAGATTTATGGGGGTAAAGTGGGTTTTGGGTATGGTAGTAAGAGGCTTTTGGGGAGTGTT
GTGGTGCCATTGGATTTGAAGAGTTTGGAGAATATTGGACATAGAGGATTTGTGATTCAG
AATGGATGGGTTTCTGTTGGTGGTGGGTCTACTGCTCAATTGAATTTAAACGTGAGAGCT
GAACCTGACCCGAGATTTGTTTTTCAGTTTGATGGAGAAGCTGAATGTAGTCCACAAGTT
TTTCAAGTTAATGGCAACGTGAAGCAACCTGTTTTTACTTGCAAGTTCAGTTTCAGAAAC
TCCGGTGACCGGAATTTGAGATCCAGATCGTCATTATCTGAAACGAGCACATCAACAAGC
TGTTTTGGTTCTTGCACATCTGATAAAGAGATATCTGTAAAAGAACGAAAAGGATGGTCA
ATTACAGTTCATGATCTTTCCGGTTCACCTGTTGCAGCAGCGTCAATGGTGACCCCATTT
GTCCCATCTCAAGGTTCGGATCGGGTCAGCAAATCCAATCCCGGATCATGGCTCATACTC
CGACCCGGTGACAACACCTGGAAGCCATGGGGTCGTCTCGAAGCTTGGCGAGAACGCAAC
GGCGAACTCGGGTACCGCTTCGAGATCATCCCGGACGGAGCCACCGACGCCATCACATTA
GTCAATTCAACAATAAGCACCAAAAAAGGTGGCAAAATCGGTATAGACATAATCAACGGA
GCTACTCCGTTGACTAGCCCCAACAGCAGCTTCGACCTAAGCTCAGGATCCGTATCCGGG
TCGGAATTCGGGTCGCAGCCCGGTTCTGGGTCGTGGGCGCAGATGCTGTATCGGGGATTT
GTGATGTCGGCGACGGTAGGAGGAGAGGGGAAATGCAGCAAACCGGAGGTGGAAGTTGGG
GTGCAGCATGTGAGTTGTGCGGAGGATGCTGCGGCGTTTGTGGCGTTGGCAGCTGCCATG
GATCTCAGTATAGATGCTTGTCGGTCATTTTCTCAGAAACTTCGAAAAGAGTTGAGACAG
CAAGACCAAGAATGATACGGTTAAAAGGGTCGGGTCGGGTCGGGTTGGGGTTGCAGTTTG
GGTTGCTTCGGGTTTCAGTTTTGCTAATTAACTAACTGACAGCAGTTTTTAGCTGGATTT
TCTTTTTATTTATTTATTTATTTATTGCCTCTTTTTTCGAGTGTACAGTGATAAGACAGC
TGTTTATTTTGAATTCCTTTTTTTTTCTCCTTCCTTTCG