Microarray Probes on PGSC0003DMT400013037

Probe IDChipProbe Sequence
CUST_9133_PI426222305 JHI_St_60k_v1 CTAAAGCAAGGGAGTTTAGTGTGCATTGAGCATATATAATTATCCAAGCTAATCTCTTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013037

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013037 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G61820.1 +1 0.0 538 264/454 (58%) beta glucosidase 46 | chr1:22835452-22838444 FORWARD LENGTH=516

Transcript Sequence (1721 bp)

>PGSC0003DMT400013037 1721 pgsc_dm_v3.4
GGCCTTTTTAATTAATTTCTCTTGTTTCCTTTGCAGTTTGAAGGAGCTTTTCTTAGTGAT
GGCAAAGGCCTTAACAATTGGGATGTTTTTACTCATGAAGCTGGCCACATAGCAGATGGA
AGTAATGGAGACATTGCTCTAGATCATTATAATCGATATCAGGAGGATATTAAGCTTATG
GAAGATATGGGAGTGAATAGCTTTCGTTTCTCTATCTCATGGGCAAGAATTCTACCTAAG
GGGATGTATGGAGGTGTCAATATGGCTGGAATTCAGCACTACAATAAGTTGATTGATGCA
CTCCTACAAAAAGATATCCAACCATTGGTCACCTTAGCACATTATGACATACCTCAAGAA
CTTGAAGAAAGATATGGAGGATGGCTAAGTCCCAAAATACAGGATGATTTTGGTTATTAT
GGAGATATATGTTTCAAATATTTTGGTGATAGAGTAAAATATTGGGTAACTATCAATGAA
CCGAATGTAGTGGCGGTTCGAGCCTATAGATTGGGTACTTTCCCTCCGGTTCGATGTTCC
GGTTCATTTGGTAATTGCAGTTTTGGGAATTCAGAAAAAGAGCCTTTTATTGCAGCACAT
AATATGATTTTATCACATGCTGCTGCTGTCACCATTTACAGAACAAAATATCAGAAAAGA
CAAGGAGGGATGATTGGAATATCTTTGAATACTCAATGGTATGAACCTTTTAGCAATTCC
TCACAAGACAATTATGCAACTCAAAGAGCTAGATCTTTTGTTTACAATTGGTTTTTGGAC
CCTATTATATATGGAAAATATCCAGAAGAAATGCAAAAAATTCTTGGAAAGAACCTGCCT
ATATTTTCAAGAAATGATATAAAAAAACTGAAAAATGGCCTAGATTTTATTGGCCTAAAT
CATTATACAGCAGCTTATATTAAAGATTGTTTGTACTCTGTCTGTGAACATGGACAATAT
TCTTCTTGGTCAGAAGGTTCTTATTTTCGTGCTACAGAAAAAGATGGTGTGTACATTGGA
GAACCTACTGCAGTGGATTGGCTATTTGTGTATCCTCAAGGGATGGAAAAGCTTGTGATG
TACATGAAGGATAGATTCAATAATACTCCGGTCATCATAACTGAAAATGGTATTGCTGAG
AGTGACCATCCAAATTCTTCCCTAGAAGATGCTCTCAATGACACTCAAAGAGTGGAGTAC
ATGCATAACTACTTGAATTCCTTGGCAAATGCAATGAGGGAAGGTGCAGATGTGAGGGGG
TATTTTGCTTGGTCATTGCTGGACAACTTTGAATGGTTAGAAGGATATACAAAAAGATTT
GGATTGCATTATGTCAATTTTACAAATCTCCAAAGAACTCCAAAATTATCAGCCACTAGG
TATAAGGAACTCATATACAACTTTCAAAGCCAACTAGCAAGATATACAGGCGCATGAACT
AGAGTTCGAGGCAGAGTCACAATGATAATTACAAATTCAATAAAATTCAATAGTTTTAAT
AGTAAAAACAATTATGATCTAAAATTCATGAAGCAAAAATTTTGTTTCCGATACTTGTCA
GAGTGAAACAAGTACAAGCACCACCATATGCCTTGTCAAGATTTCCTTATTGTTTTTCTA
AACTAAAGCAAGGGAGTTTAGTGTGCATTGAGCATATATAATTATCCAAGCTAATCTCTT
TCTTAATGTTACATATATAGTTCATTCAAATACAATATAAT