Microarray Probes on PGSC0003DMT400012487

Probe IDChipProbe Sequence
CUST_33931_PI426222305 JHI_St_60k_v1 CCAATCCATCACCCTAAGTGTTGATTTACGATCCCGGAAAGAGTTTAATTAATGTAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400012487

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400012487 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G21330.1 +2 2e-49 176 133/283 (47%) basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr3:7507720-7508841 FORWARD LENGTH=373

Transcript Sequence (1531 bp)

>PGSC0003DMT400012487 1531 pgsc_dm_v3.4
ACTTTAGCTTCTTCTATATATAAGCATGTTTCCCAACCAACATATTGCAGCTTAAGTCAG
AACATCTCCTTCAGCAACAACTAGGCAATTCTTATACATCTCTGCTTCATTTTTCATCCT
CTGCAGCTAGTTTTTCACTTATCAGATTCTGTGCACTTGGCCAAGCTTAATGTTGTCCAA
TTCATACCGTTTTGCCCCTTTCAGTAGCAAAGCTAATCCTTTAATTTCAATTCAGCAGCA
AGTTGATATCGGCGCATCGTCAGCCATGAATTTTCAGGAATTTGGAGCTGCATTTGATCC
AATCGATATCCTTTCTAGCTGGAATATCTCTCAGCGTCAAGAAGCTGCGACGAGATTGGC
TGCAGACTCTGTCGCTGCTAAATCAGGAGCAGGTTCAATTGGGGATTGTACTAATAGTAA
AATTGGTTCATCTTCTTCTTTTCCTCCGCGGAACAATTATTTGCCTTACTTGGGTAATAA
TCAAGTTCCTATTTGTGGCTTAATGGCGGATGTTAGTTCAATTGGCCTATTCTCAAAAAA
CAGATCCCCTGATTGCTTGCTTTCTGCAACCAATACAAGCAACACCAACACATCGGGCGA
ATTAGATGATGTGATTTTCTCTGATGATTCTGAAAGCTTGTGGAATATCCACACTAACAA
TGCAGTTTCATCCGGAGAATCTGCAATTGATGCCTACAAATCAAAACCCATTGATGCCAA
TGACAACAATAATATTCACTACTCTGTTAATGAGCTTGATGAAACAGTCTCGTGTAACAA
TTTTATAACATCTTCAGAAGGAAATCGTTACAATATGGACAAGAGAAGCCACAATGCTCT
GCTCGAATCAGATTCCTCGAACAGAGACTACGTATTCCAGCTCATTTCGGAAAATGATCA
ACCTAAGTCCAAGAAATCCAGATCAGAATACAAGCTTCCAAGTTCATCGAACATCAATTT
CCAGCAAGCTAGTTCTTCGGCTTGTTCAATAGTTGATCCTGATTCAGAAGCAATTGCACA
AATGAAGGAAATGATTTATCGCGCAGCAGCATTCAGGCCAGTGAGCTCTGTCAGGGAAGA
TGTGATGGCAGAGAAGCCGAAGAGGAAGAACGTAAGAATATCAATGGATCCACAAACAGC
TACAGCGAGACGAAGGAGGGAAAAGATAAGCGAAAGAATAAGGATATTGCAGAAGCTGGT
ACCAGGAGGAAGCAATATGGACACTGCATCCATGCTTGATGAGGCTGCAAACTATCTCAA
GTTCTTAAGGACACAAGTGAATGCCTTGGGAGCATTTGGCTTTAATATAGACCCAAGTAT
CATTAACAATAACTTTACTACTTCTTTATCTTCAATACCATTAATCAACTACCCATTTCC
CTTGCAACCACATTTTCCTATGCAAAACCTCAATCCAATCCATCACCCTAAGTGTTGATT
TACGATCCCGGAAAGAGTTTAATTAATGTAAAAATAAAAACATATTATCAGGTCAAATAT
ACATGTTACAACAGGTAACATGATTTATTAT