Microarray Probes on PGSC0003DMT400010342

Probe IDChipProbe Sequence
CUST_3656_PI426222305 JHI_St_60k_v1 CATGAATTTCTATATGACGACGATGGATTAAACTCACCAAACTGTACAGTTAAAGAGTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010342

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010342 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36950.1 +1 7e-101 308 177/366 (48%) mitogen-activated protein kinase kinase kinase 21 | chr4:17422834-17423844 REVERSE LENGTH=336

Transcript Sequence (1382 bp)

>PGSC0003DMT400010342 1382 pgsc_dm_v3.4
CTTCCTTTTCTCTCAACAGAAGAAACCTTAAATTACCAAATTTTCAGCTCTATAAACTTC
AGTTAATTAAACACAAAAATGGATTGGGTTAGAGGTGAAACAGTAGGCCATGGAAGCTTT
GGCAAAGTGAGTTTTGCGATTCCGAGAAACCAGAGTACTATGTTTTCTCCATCAACGGTG
GTTAAGTCTTCTTCCGCTTCCTGCTCAGCTACTTTGATGAATGAGAAGATAATCTTGGAT
GAACTTAAGGGGTGCCCACAAATTATCAATTGCGTTGGTGACAGCTACAGTTATGAAAAT
GGCGAAAAGCTGTACAATGTCTTATTGGAGTATGCTTGTGGGGGTGCTTTGTCAGACAAA
TTAAAGAATTCAAGTGATCAGAGGTTGCCGGAGTTTGAAATCAGGAAGTACACAAAGGAG
TTAATCAAAGGAATTCATTATATCCACAAGAATGGTTATGTTCACTGCGACATTAAGCTT
CCAAACATTCTTTTAAGCGAAAATGGTCAAGTCAAAATTGCTGATTTCGGATTGGCAAAG
AGAGCGGAATCAAAGAAAGATGATAAATTGAGATGTGAATTGAGGGGTACTCCGCTGTAC
ATGTCACCGGAAATGGTGATCGGAGGCGAACAGGATACTCCGGCTGATATCTGGGCACTT
GGCTGTGTGGTGGCGGAAATGGTAACTGGTAATCCAGTGTGGAGATGTTCAGATATAACT
AAATTGTTGATGACTATTGGATTGGGTGATCAATTACCTGAAATTCCTCAAAATTTATCG
GAAGAAGGAAAAGATTTTCTTGAAAAATGCTTGGTGAAGGACCCGAAAAAGAGATGGACA
GCTGAGATGCTTCTAAAACATCCCTTTGTTGCTGATGAAGATGACACTGTTTTATTGAAT
GAAGAAAGATGCAACAGTGGCAGCCCTTCAACATCTCCAAGGTGCCCATTTGATTTCCCA
GATTGGGTATCTAATAACTCTGCTGAATCCTCAGTAACATGTTCAATTACATCACTGCCC
TCACCGGCGTTTCAAGAATCGATGAACTGGAGCGATGGGTCATGGTCTACATCACCAACA
GAGAGAATTCGGGAATTAGTGTGTGAATGTAGACCTGAATTTGAATGGTCTACTGCTGAT
GGCTGGGTCAGCGTTAGGTGAAGTCAATTTTGTAGTAAAAAAAATTTAGTCATAGATAAT
TCAGAGTTCTGAAGATTCTTGCTTAGCCAATTTAGTGATTAGGCTAGGCCAATTCGTTCA
ATTTTTTTGTACAAAATACATACATGAATTTCTATATGACGACGATGGATTAAACTCACC
AAACTGTACAGTTAAAGAGTACTTTTTTAGTTTCTTAATTTGTTATTACTTCCTATATCA
AA