Microarray Probes on PGSC0003DMT400009621

Probe IDChipProbe Sequence
CUST_7594_PI426222305 JHI_St_60k_v1 CGGCCAAAAGATTTTTATGCCTTCTTTTAATCCTAATATTGCTACTTGGTGACGTTTGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009621

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009621 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G75450.1 +1 0.0 725 369/524 (70%) cytokinin oxidase 5 | chr1:28315248-28318064 REVERSE LENGTH=540

Transcript Sequence (2094 bp)

>PGSC0003DMT400009621 2094 pgsc_dm_v3.4
AACTCATAAACTTTACTATAAACTTTTTCTTTTCTTTTTAGCAAATATGAACATTTCTTA
CACCTTCAAATATCTTTTGACGTTATTAATGATTTGCTCTTGAGAAAAAAAAAGGATTTT
TGAGAATCTTTTGCATGTTTTTGATTTTGGTAAATCTTTAAAGTGTAATCTGTCTTACGT
TAGTCCCACGCTTCTGCTGACGATCCTGGTACTTCTCTTCCTGCCACAAGATTTTGTTCC
CTTTTCCCAAAGTCGTGGTATTTTAAATTTTGAATCCGCCTTTATATACGAACAAGTTCC
TCCTTCCTCTTTACAATTTTTAGTTTCACTATGGCTACGAAATTATTGTTAACGTTAGCG
ATATGTCGCTTAATTGTTACCGTGGGATTTACTTTTAACCCGAATGACCTTTTACTGCTC
GGGCTCAATGGGAAACTCAGCGTGGCTCCAGCCGATTTACAATCCGCTTCGGTTGATTTC
GGCGGAGTGTATAAAGCCGAGCCGATGGCGGTTCTTCACCCGGCTACATCCGAGGATGTA
GCGCGGTTAGTGAAGGCCGCGTACGACTCGGCTCGTGGGTTCACCGTGTCGGCTAGAGGT
CATGGACATTCTATAAATGGTCAAGCCATGACGACAAATGGCGTTGTGGTTCAAATGAGC
GGCGGTGGCGGCTCGAAAAATAAGATGTTAACTATTTCGGAGAAATTCATGTACGCTGAT
GTTTGGGGTGGAGAGTTATGGATTGATGTGTTGACGTCCACATTAGAATACGGTCTCGCA
CCGAAATCATGGACTGATTATTTGTACTTAACTGTGGGTGGTACTCTCTCTAATGCTGGA
ATTAGTGGTCAAGCTTTTAATCATGGCCCTCAAATTAGCAATGTCCATGAACTCGATGTT
GTTACAGGTAAGGGTGAGCTATTGACATGTTCAGAAAAAGAAAATTCTGAGCTGTTTCAA
GCCGTTCTTGGTGGATTAGGACAATTTGGGATCATAACAAGAGCAAGAATTGCACTTGAA
CAAGCTCCTCAAAGGGTGAGGTGGATTCGAGTACTATATTCCAATTTTTCAACATTTACA
CAAGACCAAGAATATTTAATATCATTGCATGGAAAACCAGCTTCACAAAAATTTGATTAT
GTTGAAGGATTTGTTATAGTTGATGAAGGTTTGATAAATAATTGGAGGTCTTCTTTTTTC
TCACCAAGTAACCCTGTGAAAATTTCTTCTCTCAAGGCTGAAGGAGGTGTTTTATATTGC
TTGGAAATTACCAAAAATTATCACCTTTCAAATGCTGATACCATTGATCAGGAGATTGAA
ATATTATTGAAAAAATTAAATTATATACCAGCTTCAGAGTTCAGAACGGACCTTCCTTAC
GTGGATTTTTTGGACCGGGTTCACAAGGCCGAGTTAAAACTCCGGTCTAAAGGTTTATGG
GAAGTGCCACATCCATGGCTAAACTTATTTGTACCAAAATCAAGAATTGCTGAGTTTGAT
AAAGGAGTATTTAAGGGCATTTTGGGAAACAAAACTAGTGGTCCAATACTCATATACCCT
ATGAACAAAAACAAATGGGACGATAGGAGTTCGGTAGTTACACCAGAAGAAGATGTGTTT
TACTTGGTCGCGTTTTTGAGGTCTGCATTGGAGAATGGTGATGAGACACAAACGTTGGAT
TACCTAAGTAATCAAAATTATGAAATATTGAAGTTTTGTGAGGATGAAAAGATCAATGTG
AAACAATATTTGCCTCATTATGACAATCAAAGAGAATGGAGGGACCATTTTGGAGAAAAA
TATTGGACAAGATTTCAACAAAGAAAATTAGAGTTTGATCCAAGGCATATATTAGCAACC
GGCCAAAAGATTTTTATGCCTTCTTTTAATCCTAATATTGCTACTTGGTGACGTTTGATT
AGCTATTAATTAATTGGTATTAGTTATTAATTAGGATTTAGGATTAGTTGAGATCAGAAT
TAGTTAGTTGTAGATTTTATAGTATCATGTTTAGTGTATTTTATGTACATATCAAGTGGG
AAAAAAGAGCAAAAATTATTAATTCACTTAATTATTTAGTAAAGAAGAAATCTT