Microarray Probes on PGSC0003DMT400009094

Probe IDChipProbe Sequence
CUST_5352_PI426222305 JHI_St_60k_v1 CAAGCAAAACTAACTGTGTTCTTCATTATTTACATCCTTAATCTCTCCAACATGTTGCTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009094

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009094 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36380.1 +1 0.0 566 303/464 (65%) Cytochrome P450 superfamily protein | chr4:17187973-17192202 REVERSE LENGTH=524

Transcript Sequence (1782 bp)

>PGSC0003DMT400009094 1782 pgsc_dm_v3.4
ATCTCCTCTGCTTATATTTCTTCAAAAAAGAAAAATAAAACCCCACCACCTCTGTTTCTC
TCTCTTCTCTCTTGGTATACATAAAACTTTATGTGAAAAGCAGAAATGTTTTCTATTGTT
GTGAAAATGGAAGAGAAAGCAGAAAATTGGATTTGGATATGTATGGTAGCAGTTTTGTGG
CTGATTTATAAGATGAGAAAAAAGCAAAATGAAGAGAAAGAAAGGGCAATTGGAGTTCCA
AGAGGAAATTCTGGTTGGCCTCTTTTAGGAGAAACGCTCGATTTCATTGCTTCTGGATGC
TCTTCTCGTCCTGTCACTTTCATGGAAAAACGAAAGTCCCTGTACGGGAATGTGTTCAAA
AGTAATATACTAGGAAAAGGAATAATAGTATCAACAGATGCAGAGGTGAACAAAGTGGTT
CTACAGAACAATGGAGATGTATTTATACCATGTTATCCAAAATCAATAACAGAATTATTT
GGGAAGAATTCGATATTGCAAATGAATGGGCCAGTTCATAGAAGACTACACGGACTGATC
GGGAATTTCTTAAAATCGCCGCAACTCAAGGCTCGTATTACACGAGACATCGAAGCCTCT
GTTCGCCATTTCTTGTCAACATGGCTGGAAAAACAACACAGCATCGTCTATGTACAAGAT
GAAGCCAAAAAGATTTCATTTGAAGTATTAGTCAAGCTGATACTAAGCGTGGACCCTGGA
GAAGAATTGAACTTGCTCAAGAAAGAATTTGAAGAACTCACCAAAGGCTTGATTTGTTTG
CCCATTAAGCTTCCCGGAACCACTCTCTACAAATCTTTAAAGGCGAAAGAAAGGTTAACA
AGAATGGTAGGGAAGATGGTAGAGAAGAGAAAATTGAGCATGGAGAAAAAAGAAGAAAAG
GGGTTCCCAAAAGATGCAATTGACGTGCTCTTAGGGAATGCTGATGGGGCAAAGCAACCT
CTGCCGTATGATTTCATCAGTGCCAACTTGATAGAGATGATGATCCCTGGAGAAGAGACC
GTACCAACGGCGATCACCTTAGCTGTCAAATTTCTAAGTGACTATCCCGTCGCTCTAGAT
CGCTTGCTGGAGGAGAATTTGGAATTGAAGCAGCAGAAGATAAGCTGCTGTGAGGATTAT
AGTTGGACAGATTATTTGTCAATGCCCTTCACTCAGAATGTTATCAGTGAAACGTTGAGA
TTGGCAAATATCATTAATGCAGTTTGGAGAAAATCTCTCAAAGATGTCAAAATTAAAGGG
CATTTGATACCAAAAGGATGGTGTGTTTTGGCATCTTTCACTTCAGTTCACATGGATGAA
GAAAATTATGAAAATCCATACAATTTTGATCCCTCCAGATGGGAGAAAGTTGGAGTTACT
GTGACCAGCAATACATTTACACCCTTTGGTGGAGGACAGAGGCTATGTCCTGGTTTAGAA
CTTTCAAGGCTTGAAATCTCCATTTTCCTCCACCATCTTGTCACCACCTACCGATGGGTG
GCAGAGAAGGATGAGATTGTCTATTTTCCAACAGTGAAGATGAAGAACAAACTGCCTATC
AACATCATGCCCCTTCAGCAAAGCCCACTAATTCAAACCAAGCAAAACTAACTGTGTTCT
TCATTATTTACATCCTTAATCTCTCCAACATGTTGCTGTTTATCTACAATTTATTTTTTT
ATGTAACCAACATCTTTTATTATCTCAACCATATATACATCTCAATGTTAAAGGTAGCAA
ACTAAATACAAGGTTTATATTTTTTTTTAAAATAGATTAATA