Microarray Probes on PGSC0003DMT400008074

Probe IDChipProbe Sequence
CUST_41327_PI426222305 JHI_St_60k_v1 TCTTTCCAATCACACTAGCTACATTCCCAGACCCAGATGGCATAAGGATGGAGATAACTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008074

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008074 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G21860.1 +1 9e-70 214 106/166 (64%) methionine sulfoxide reductase B 2 | chr4:11600238-11601507 REVERSE LENGTH=202

Transcript Sequence (549 bp)

>PGSC0003DMT400008074 549 pgsc_dm_v3.4
ATGGACTCTCAGATTCTAAAATTTTCGCCAATTATTTCTTCAAGAAATATCACTTTCAAC
TCCAAAAAAGCAGTTCACATTCATGGCCTGTCCAATACCCAATTCAGGGTTTCAGCAGCA
AGGTCCGTTCAGAAGTCAGAGGAGGAATGGCGTGCCGTTCTCTCCCCTGATCAATTCCGG
ATTTTGAGGCAGAAAGGCACAGAGAATCAAGGGAGTGGGGAGTATAACAAGTTTTTTGGT
GTAGGCACCTACCTCTGTGCTGGTTGTGGCACTCCACTCTACAGATCCGCAACCAAATTC
AACTCACCCTGTGGCTGGCCTTCTTTTTATGAGGGTCTCCCTGGCGCCATAAATCGCAAT
GTGAGCTTCTTTCCAATCACACTAGCTACATTCCCAGACCCAGATGGCATAAGGATGGAG
ATAACTTGTGCTGCTTGTGGAGGCCATATTGGTCATGTTTTTAAAGGTGAATGGTTTCGT
ACCCCAACAAATGAACGCCATTGTGTCAACAGTATATCCCTCAAGTTCAAACCACCGCAA
TTTTCTTAA