Microarray Probes on PGSC0003DMT400007625

Probe IDChipProbe Sequence
CUST_4144_PI426222305 JHI_St_60k_v1 GGTGCAAAGGGAGAATTGGAAAATCTACTCAAAATTGCTCAACTCAAAGCATTTTTAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400007625

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400007625 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G46530.1 +3 4e-18 71 32/94 (34%) NB-ARC domain-containing disease resistance protein | chr3:17130739-17133246 REVERSE LENGTH=835

Transcript Sequence (2603 bp)

>PGSC0003DMT400007625 2603 pgsc_dm_v3.4
ACAAGCTAATAGTTGAAAAAAAAAAGAAAAATATCTTTGTTAGATTTGTAATAACCAATT
GAAAGGAGATATGGCAGATGCAGTGGTGAATTTTCTGGTAGAGAATTTGTTGCAGCTATT
GGAGGTGCAAAGGGAGAATTGGAAAATCTACTCAAAATTGCTCAACTCAAAGCATTTTTA
GATGATGCTGCAAAATTCGGATACACGAATAGTGAGCAGTGGAAAGTTTTGGTGATAGAA
ATTCATAAAACTGTGCACAGAGCTGAAGATGCCATTGATAAATTTCTGGTTTAAGCAAAG
CTGCATCAAGATAAAAATACGATGGGAAGGATATTCGATTGGCCACGTAATCTGATTAAA
GTTAGGAATCTTGCTGCTGAGATTAAAGGAATAAATGATCAAGTCAAAGAACTTCGTAGC
AGCAATCAAGCACTTCAGGCCACCCCTGTTATTGAGCACCATAAAAAAGAGGAAGTAACT
CAGGGTCCTTCTTTGGAGAATGATGCAGTGGTCGGGTTTGATGACGAAGCTAATAAAGTG
ATCAAGCGACTTGTTGAAGGACCGATGGACAGTGTGGATATTATCCCAGTTGTGGGAATG
CCCGGACTTGGAAAAACTACACTGGCAAGAAAAATCTATAATGATTCTAAGCTTACAAAT
AAATTTTATAGCATTGTTTGGGTTTACGTCGGTCAGGAATGCAAAGCAAAGGATATTTAT
CTTAGGATTCTTAAATTCTTCAAAAAAACCATAGAAGATCATCTCAATGACGATGTGGAC
ACATTTGGCTAAGGCAATAGGTAGTTATATCAAGAAAGGAGGTAGATGTCTCATTGTTTT
AGATGATGTGTGGGAAGTTGAGTTATGATCATTTGCCCCAAGAAGTGCAGATGTGCTTCT
TGTATTGTGGTGTCTTTCCTCGAGGCTTTGATATCCCTTGTTGGAAATTGATTCGTTTGT
GGATAGCAGAGGGGTTGATAAAGCCGCAGCCTAACTTCACTCTAGAGGAGATAGCAGAGT
TTTGTTTGACAGATCTTCTCAACAGAAATTTAGTAATAATAATGCAAAAGAGGTCTGATG
GTCAAATAAAAACATGTCGTCTTCACGATATGTTGTATCAGTTCTGCAAAAAGGAGGCTA
GTAACAGATGGCTTTTTCAAGAACCTGATCAATCTACCCTGGACCCAGATACTTGCCGTC
AATTGTGTATTCAACCATCTAATCTGTCTGACTTTCTCTCCAAACACCTTTTGCAGAACA
TGTCAGATCTTTCTATTGTTTTTCCTCAAAACAAAAACCAATTGACTTGTCTCCTAATGA
AATCAAACTCATTCACAAAGCCTTTCCACTTATGAGAGTCTTGGATGTTGAATCTCTCAA
GTTTATTTTCTCCAAAGACTTCAACCAATTATTTCATTTGAGGTATATTGCTATCTCAGG
TGACTTTAAGGCCCTCCCTCCTACCTTTGGTAAATTCTGGAATTTACAAACTCTAATACT
TAATACAAGTACCTTAGAGCCCACTCTTGAAGTAAAAGCAGAAATATGGAACTTGTTACA
GTTGAGGCATCTCCACACCAACATACCTGCAAAATTGCCATCCCCGACTACCACCACAGG
TAAACCTTCTTGTCTACAGACTCTTTCTATGGTTGCGCCAGAAAGTTGTGAGAAAGATGT
GCTAGCAAAGGCCTGTAATGTAAGAAAATTGAGCATTCAAGGGCAAATGGCGGCTTTTCT
TGGTGCTTACAAGGGTGGTATCAACAATCTTGAAGAGCTACAGTGTCTGGAACATTTGAA
ATTGTTGAATGATGTTCTTTTCATAAATAAAACACTTCACCTTCCACTAGCATTCTCCAA
ACTGGTACGTACGGTGAAGAAGTTGACTCTGACAAACACAAGGTTTGCTTGGAGTGAGGC
GGATAAATTGGGGGACGTTTGGAATCTCTTTGAGGTCCTAAAGTTTAAGAAAATGCATTC
ACGGGTGATCTCTGGAAGCCAAAGAGTGGATTTAGCGCACTCCAAGTCTTGTGGATTGAA
AGGTCAGAATTAGAATCTTGGGAGGCTTCGGTTATTAACTTCCCCGTGCTTAGGCAACTT
GTTCTTATCTCTTGTGATGAGCTCGATGCTGTGCCACTTGAGCTGGCTGATATACTTAGC
CTTCAAGAGATGAGACTTGAGAACACAAGCAAAGCAGTAAAATCCGCAAAAAGTGTTCGG
GATAGCAAGACATCTAAAGCATGGAACTCAAGCTAAGCATATTCCCTCCTGAAAATGAAT
CCAAGGTTCCACAGTGATATAAAAGGAGAGAACTTGGACATTGAGTTTGCTGGAAGCCAG
AGCTCATCAGACAAATAACTGGAGTAGTGTGATTTTGAAATAAGGCTAGTTCTGCTGCAT
CTCGAGTTCCCCTTTATGTAAATTGTTTTTTTTTCTTGGTTGTGAAACTGTTTGCATCTT
TCCTATTCTGTTATCTTTGTATTTGCTTTGTTTCATTTGTGTAAAACTGTTGTTTGCATC
TTTCCTATTCTGTTATCTTTGTATTTGCTTTGTTTCATTCGTGTAAAACTGTTGTTTTAA
TCTATCATTGTTTTTGTTGAAAG