Microarray Probes on PGSC0003DMT400006306

Probe IDChipProbe Sequence
CUST_42226_PI426222305 JHI_St_60k_v1 CTCATGACAAGGTGGTTTCATTTCTTCTATTTCTCAAAAATAAGGTCTTCAAAGCTCCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006306

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006306 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G74590.1 +1 7e-16 71 38/117 (32%) glutathione S-transferase TAU 10 | chr1:28023887-28024666 REVERSE LENGTH=232

Transcript Sequence (375 bp)

>PGSC0003DMT400006306 375 pgsc_dm_v3.4
ATGTGCGCGCAGGTGTATGATTGCATGCTGAAGGTGTTCAGAGGGGAAGAACAAGACAAA
GCATTAGAGGAATATTGCGCGAAATTGAGTGTGCTGGAAGATGGAATTAACAGCTCCTCA
CTGGGGATAACAAGTAATATGAACAACATAGGTATGCTGGATATTATGATTGTTATTACA
TTAGGGGCATACAAAGTACAAGAAGAAGTATTTGGTTTCAAGTTATTGGAAGAAGAGAAG
ACACCATTGTTATACTCATGGGTCACTACTCTAATTGAGTTACCTATAGTTAAAGGAATC
ACTCCCTCTCATGACAAGGTGGTTTCATTTCTTCTATTTCTCAAAAATAAGGTCTTCAAA
GCTCCAATCAGTTAA